Granzyme A (GZMA) (NM_006144) Human Untagged Clone

CAT#: SC320921

GZMA (untagged)-Human granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3) (GZMA)


  "NM_006144" in other vectors (7)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "GZMA"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GZMA
Synonyms CTLA3; HFSP
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_006144.2 CAGCCACAATGAGGAACTCCTATAGATTTCTGGCATCCTCTCTCTCAGTTGTCGTTTCTC
TCCTGCTAATTCCTGAAGATGTCTGTGAAAAAATTATTGGAGGAAATGAAGTAACTCCTC
ATTCAAGACCCTACATGGTCCTACTTAGTCTTGACAGAAAAACCATCTGTGCTGGGGCTT
TGATTGCAAAAGACTGGGTGTTGACTGCAGCTCACTGTAACTTGAACAAAAGGTCCCAGG
TCATTCTTGGGGCTCACTCAATAACCAGGGAAGAGCCAACAAAACAGATAATGCTTGTTA
AGAAAGAGTTTCCCTATCCATGCTATGACCCAGCCACACGCGAAGGTGACCTTAAACTTT
TACAGCTGACGGAAAAAGCAAAAATTAACAAATATGTGACTATCCTTCATCTACCTAAAA
AGGGGGATGATGTGAAACCAGGAACCATGTGCCAAGTTGCAGGGTGGGGCAGGACTCACA
ATAGTGCATCTTGGTCCGATACTCTGAGAGAAGTCAATATCACCATCATAGACAGAAAAG
TCTGCAATGATCGAAATCACTATAATTTTAACCCTGTGATTGGAATGAATATGGTTTGTG
CTGGAAGCCTCCGAGGTGGAAGAGACTCGTGCAATGGAGATTCTGGAAGCCCTTTGTTGT
GCGAGGGTGTTTTCCGAGGGGTCACTTCCTTTGGCCTTGAAAATAAATGCGGAGACCCTC
GTGGGCCTGGTGTCTATATTCTTCTCTCAAAGAAACACCTCAACTGGATAATTATGACTA
TCAAGGGAGCAGTTTAAATAACCGTTTCCTTTCATTTACTGTGGCTTCTTAATCTTTTCA
CAAATAAAATCAATTTGCATGACTGTAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_006144
Insert Size 900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_006144.2, NP_006135.1
RefSeq Size 878 bp
RefSeq ORF 789 bp
Locus ID 3001
Cytogenetics 5q11.2
Domains Tryp_SPc
Protein Families Druggable Genome, Protease, Secreted Protein
Protein Pathways Neuroactive ligand-receptor interaction
Gene Summary 'Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells. [provided by RefSeq, Jul 2008]'

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.