TATA binding protein (TBP) (NM_003194) Human Untagged Clone
CAT#: SC322062
TBP (untagged)-Human TATA box binding protein (TBP), transcript variant 1
"NM_003194" in other vectors (7)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | TBP |
| Synonyms | GTF2D; GTF2D1; HDL4; SCA17; TFIID |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_003194, the custom clone sequence may differ by one or more nucleotides
ATGGATCAGAACAACAGCCTGCCACCTTACGCTCAGGGCTTGGCCTCCCCTCAGGGTGCCATGACTCCCG GAATCCCTATCTTTAGTCCAATGATGCCTTATGGCACTGGACTGACCCCACAGCCTATTCAGAACACCAA TAGTCTGTCTATTTTGGAAGAGCAACAAAGGCAGCAGCAGCAACAACAACAGCAGCAGCAGCAGCAGCAG CAGCAACAGCAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC AACAGGCAGTGGCAGCTGCAGCCGTTCAGCAGTCAACGTCCCAGCAGGCAACACAGGGAACCTCAGGCCA GGCACCACAGCTCTTCCACTCACAGACTCTCACAACTGCACCCTTGCCGGGCACCACTCCACTGTATCCC TCCCCCATGACTCCCATGACCCCCATCACTCCTGCCACGCCAGCTTCGGAGAGTTCTGGGATTGTACCGC AGCTGCAAAATATTGTATCCACAGTGAATCTTGGTTGTAAACTTGACCTAAAGACCATTGCACTTCGTGC CCGAAACGCCGAATATAATCCCAAGCGGTTTGCTGCGGTAATCATGAGGATAAGAGAGCCACGAACCACG GCACTGATTTTCAGTTCTGGGAAAATGGTGTGCACAGGAGCCAAGAGTGAAGAACAGTCCAGACTGGCAG CAAGAAAATATGCTAGAGTTGTACAGAAGTTGGGTTTTCCAGCTAAGTTCTTGGACTTCAAGATTCAGAA TATGGTGGGGAGCTGTGATGTGAAGTTTCCTATAAGGTTAGAAGGCCTTGTGCTCACCCACCAACAATTT AGTAGTTATGAGCCAGAGTTATTTCCTGGTTTAATCTACAGAATGATCAAACCCAGAATTGTTCTCCTTA TTTTTGTTTCTGGAAAAGTTGTATTAACAGGTGCTAAAGTCAGAGCAGAAATTTATGAAGCATTTGAAAA CATCTACCCTATTCTAAAGGGATTCAGGAAGACGACGTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_003194 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_003194.3, NP_003185.1 |
| RefSeq Size | 1867 bp |
| RefSeq ORF | 1020 bp |
| Locus ID | 6908 |
| Cytogenetics | 6q27 |
| Domains | TBP |
| Protein Families | Druggable Genome, Transcription Factors |
| Protein Pathways | Basal transcription factors, Huntington's disease |
| Gene Summary | 'Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes TBP, the TATA-binding protein. A distinctive feature of TBP is a long string of glutamines in the N-terminus. This region of the protein modulates the DNA binding activity of the C terminus, and modulation of DNA binding affects the rate of transcription complex formation and initiation of transcription. The number of CAG repeats encoding the polyglutamine tract is usually 25-42, and expansion of the number of repeats to 45-66 increases the length of the polyglutamine string and is associated with spinocerebellar ataxia 17, a neurodegenerative disorder classified as a polyglutamine disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2016]' Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| SC118124 | TBP (untagged)-Human TATA box binding protein (TBP), transcript variant 1 |
USD 760.00 |
|
| RC210727 | TBP (Myc-DDK-tagged)-Human TATA box binding protein (TBP), transcript variant 1 |
USD 457.00 |
|
| RG210727 | TBP (GFP-tagged) - Human TATA box binding protein (TBP), transcript variant 1 |
USD 460.00 |
|
| RC210727L1 | Lenti ORF clone of Human TATA box binding protein (TBP), transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
| RC210727L2 | Lenti ORF clone of Human TATA box binding protein (TBP), transcript variant 1, mGFP tagged |
USD 620.00 |
|
| RC210727L3 | Lenti ORF clone of Human TATA box binding protein (TBP), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
| RC210727L4 | Lenti ORF clone of Human TATA box binding protein (TBP), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China