ATF 4 (ATF4) (NM_182810) Human Untagged Clone
CAT#: SC322421
ATF4 (untagged)-Human activating transcription factor 4 (tax-responsive enhancer element B67) (ATF4), transcript variant 2
"NM_182810" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ATF4 |
Synonyms | CREB-2; CREB2; TAXREB67; TXREB |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for SC322421
CAGATGTAGTTTTCTCTGCGCGTGTGCGTTTTCCCTCCTCCCCCGCCCTCAGGGTCCACG
GCCACCATGGCGTATTAGGGGCAGCAGTGCCTGCGGCAGCATTGGCCTTTGCAGCGGCGG CAGCAGCACCAGGCTCTGCAGCGGCAACCCCCAGCGGCTTAAGCCATGGCGCTTCTCACG GCATTCAGCAGCAGCGTTGCTGTAACCGACAAAGACACCTTCGAATTAAGCACATTCCTC GATTCCAGCAAAGCACCGCAACATGACCGAAATGAGCTTCCTGAGCAGCGAGGTGTTGGT GGGGGACTTGATGTCCCCCTTCGACCCGTCGGGTTTGGGGGCTGAAGAAAGCCTAGGTCT CTTAGATGATTACCTGGAGGTGGCCAAGCACTTCAAACCTCATGGGTTCTCCAGCGACAA GGCTAAGGCGGGCTCCTCCGAATGGCTGGCTGTGGATGGGTTGGTCAGTCCCTCCAACAA CAGCAAGGAGGATGCCTTCTCCGGGACAGATTGGATGTTGGAGAAAATGGATTTGAAGGA GTTCGACTTGGATGCCCTGTTGGGTATAGATGACCTGGAAACCATGCCAGATGACCTTCT GACCACGTTGGATGACACTTGTGATCTCTTTGCCCCCCTAGTCCAGGAGACTAATAAGCA GCCCCCCCAGACGGTGAACCCAATTGGCCATCTCCCAGAAAGTTTAACAAAACCCGACCA GGTTGCCCCCTTCACCTTCTTACAACCTCTTCCCCTTTCCCCAGGGGTCCTGTCCTCCAC TCCAGATCATTCCTTTAGTTTAGAGCTGGGCAGTGAAGTGGATATCACTGAAGGAGATAG GAAGCCAGACTACACTGCTTACGTTGCCATGATCCCTCAGTGCATAAAGGAGGAAGACAC CCCTTCAGATAATGATAGTGGCATCTGTATGAGCCCAGAGTCCTATCTGGGGTCTCCTCA GCACAGCCCCTCTACCAGGGGCTCTCCAAATAGGAGCCTCCCATCTCCAGGTGTTCTCTG TGGGTCTGCCCGTCCCAAACCTTACGATCCTCCTGGAGAGAAGATGGTAGCAGCAAAAGT AAAGGGTGAGAAACTGGATAAGAAGCTGAAAAAAATGGAGCAAAACAAGACAGCAGCCAC TAGGTACCGCCAGAAGAAGAGGGCGGAGCAGGAGGCTCTTACTGGTGAGTGCAAAGAGCT GGAAAAGAAGAACGAGGCTCTAAAAGAGAGGGCGGATTCCCTGGCCAAGGAGATCCAGTA CCTGAAAGATTTGATAGAAGAGGTCCGCAAGGCAAGGGGGAAGAAAAGGGTCCCCTAGTT GAGGATAGTCAGGAGCGTCAATGTGCTTGTACATAGAGTGCTGTAGCTGTGTGTTCCAAT AAATTATTTGGTAGGGAAAGTAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_182810 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_182810.1, NP_877962.1 |
RefSeq Size | 1420 bp |
RefSeq ORF | 1056 bp |
Locus ID | 468 |
Cytogenetics | 22q13.1 |
Protein Families | Transcription Factors |
Protein Pathways | GnRH signaling pathway, Long-term potentiation, MAPK signaling pathway, Neurotrophin signaling pathway, Prostate cancer |
Gene Summary | 'This gene encodes a transcription factor that was originally identified as a widely expressed mammalian DNA binding protein that could bind a tax-responsive enhancer element in the LTR of HTLV-1. The encoded protein was also isolated and characterized as the cAMP-response element binding protein 2 (CREB-2). The protein encoded by this gene belongs to a family of DNA-binding proteins that includes the AP-1 family of transcription factors, cAMP-response element binding proteins (CREBs) and CREB-like proteins. These transcription factors share a leucine zipper region that is involved in protein-protein interactions, located C-terminal to a stretch of basic amino acids that functions as a DNA binding domain. Two alternative transcripts encoding the same protein have been described. Two pseudogenes are located on the X chromosome at q28 in a region containing a large inverted duplication. [provided by RefSeq, Sep 2011]' Transcript Variant: This variant (2) lacks an internal segment in the 5' UTR, compared to variant 1. The protein translation of this variant is regulated by two upstream open reading frames (PMID: 15277680). Both variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC127457 | ATF4 (untagged)-Human activating transcription factor 4 (tax-responsive enhancer element B67) (ATF4), transcript variant 2 |
USD 310.00 |
|
RC202333 | ATF4 (Myc-DDK-tagged)-Human activating transcription factor 4 (tax-responsive enhancer element B67) (ATF4), transcript variant 2 |
USD 420.00 |
|
RG202333 | ATF4 (GFP-tagged) - Human activating transcription factor 4 (tax-responsive enhancer element B67) (ATF4), transcript variant 2 |
USD 460.00 |
|
RC202333L1 | Lenti ORF clone of Human activating transcription factor 4 (tax-responsive enhancer element B67) (ATF4), transcript variant 2, Myc-DDK-tagged |
USD 768.00 |
|
RC202333L2 | Lenti ORF clone of Human activating transcription factor 4 (tax-responsive enhancer element B67) (ATF4), transcript variant 2, mGFP tagged |
USD 620.00 |
|
RC202333L3 | Lenti ORF clone of Human activating transcription factor 4 (tax-responsive enhancer element B67) (ATF4), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC202333L4 | Lenti ORF clone of Human activating transcription factor 4 (tax-responsive enhancer element B67) (ATF4), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review