CBX1 (NM_001127228) Human Untagged Clone

CAT#: SC322874

CBX1 (untagged)-Human chromobox homolog 1 (CBX1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CBX1
• Synonyms: CBX; HP1-BETA; HP1Hs-beta; HP1Hsbeta; M31; MOD1; p25beta
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001127228, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGGAAAAAACAAAACAAGAAGAAAGTGGAGGAGGTGCTAGAAGAGGAGGAAGAGGAATATGTGGTGG
  AAAAAGTTCTCGACCGTCGAGTGGTAAAGGGCAAAGTGGAGTACCTCCTAAAGTGGAAGGGATTCTCAGA
  TGAGGACAACACATGGGAGCCAGAAGAGAACCTGGATTGCCCCGACCTCATTGCTGAGTTTCTGCAGTCA
  CAGAAAACAGCACATGAGACAGATAAATCAGAGGGAGGCAAGCGCAAAGCTGATTCTGATTCTGAAGATA
  AGGGAGAGGAGAGCAAACCAAAGAAGAAGAAAGAAGAGTCAGAAAAGCCACGAGGCTTTGCTCGAGGTTT
  GGAGCCGGAGCGGATTATTGGAGCTACAGACTCCAGTGGAGAGCTCATGTTCCTGATGAAATGGAAAAAC
  TCTGATGAGGCTGACCTGGTCCCTGCCAAGGAAGCCAATGTCAAGTGCCCACAGGTTGTCATATCCTTCT
  ATGAGGAAAGGCTGACGTGGCATTCCTACCCCTCGGAGGATGATGACAAAAAAGATGACAAGAACTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001127228
• ORF Size: 558 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001127228.1, NP_001120700.1
• RefSeq Size: 2253
• RefSeq ORF: 558
• Locus ID: 10951
• Gene Summary: This gene encodes a highly conserved nonhistone protein, which is a member of the heterochromatin protein family . The protein is enriched in the heterochromatin and associated with centromeres. The protein has a single N-terminal chromodomain which can bind to histone proteins via methylated lysine residues, and a C-terminal chromo shadow-domain (CSD) which is responsible for the homodimerization and interaction with a number of chromatin-associated nonhistone proteins. The protein may play an important role in the epigenetic control of chromatin structure and gene expression. Several related pseudogenes are located on chromosomes 1, 3, and X. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein.