FXYD4 (NM_001184963) Human Untagged Clone

CAT#: SC328157

FXYD4 (untagged)-Human FXYD domain containing ion transport regulator 4 (FXYD4) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FXYD4
• Synonyms: CHIF
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001184963, the custom clone sequence may differ by one or more nucleotides
  ATGGAGAGAGTGACCCTGGCCCTTCTCCTACTGGCAGGCCTGACTGCCTTGGAAGCCAAT
  GACCCATTTGCCAATAAAGACGATCCCTTCTACTATGACTGGAAAAACCTGCAGCTGAGC
  GGACTGATCTGCGGAGGGCTCCTGGCCATTGCTGGGATCGCGGCAGTTCTGAGTGGCAAA
  TGCAAATGCAAGAGCAGCCAGAAGCAGCACAGTCCTGTACCTGAGAAGGCCATCCCACTC
  ATCACTCCAGGCTCTGCCACTACTTGCTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001184963
• ORF Size: 270 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001184963.1, NP_001171892.1
• RefSeq Size: 636
• RefSeq ORF: 270
• Locus ID: 53828
• Protein Families: Ion Channels: Other, Transmembrane
• Gene Summary: This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The approved human gene nomenclature for the family is FXYD-domain containing ion transport regulator. FXYD4, originally named CHIF for channel-inducing factor, has been shown to modulate the properties of the Na,K-ATPase, as has FXYD2, also known as the gamma subunit of the Na,K-ATPase, and FXYD7. Transmembrane topology has been established for FXYD4 and two family members (FXYD1 and FXYD2), with the N-terminus extracellular and the C-terminus on the cytoplasmic side of the membrane. Alternatively spliced transcript variants encoding the same protein have been found. [provided by RefSeq, May 2010]
  Transcript Variant: This variant (2) represents use of an alternate splice acceptor site in the 5' UTR, as compared to variant 1. This variant is likely to only be found in individuals with the A allele of SNP rs10899795, which is polymorphic in most populations.