Cadherin like 23 (CDH23) (NM_001171935) Human Untagged Clone

CAT#: SC328409

CDH23 (untagged)-Human cadherin-related 23 (CDH23) transcript variant 8

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CDH23
• Synonyms: CDHR23; PITA5; USH1D
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001171935, the custom clone sequence may differ by one or more nucleotides
  ATGCGGTCCTGGTTCCAGCAGGATCCTATGGTGGGAGCATGCACCACAGGCACCAGGGCC
  TCACACCCCAAAGCCAACCCTGTGTGGCTGGATCCCTTCTGTCGGAACCTGGAGCTGGCC
  GCCCAGGCGGAGCATGAGGATGACCTACCGGAGAACCTGAGTGAGATCGCCGACCTGTGG
  AACAGCCCCACGCGCACCCATGGAACTTTTGGGCGTGAGCCAGCAGCTGTCAAGCCTGAT
  GATGACCGATACCTGCGGGCTGCCATCCAGGAGTATGACAACATTGCCAAGCTGGGCCAG
  ATCATTCGTGAGGGGCCAATCAAGGGCTCGCTGCTGAAGGTGGTCCTGGAGGATTACCTG
  CGGCTCAAAAAGCTCTTTGCACAGCGGATGGTGCAAAAAGCCTCCTCCTGCCACTCCTCC
  ATCTCTGAGCTGATACAGACTGAGCTGGACGAGGAGCCAGGAGACCACAGCCCAGGGCAG
  GGTAGCCTGCGCTTCCGCCACAAGCCACCAGTGGAGCTCAAGGGGCCCGATGGGATCCAT
  GTGGTGCACGGCAGCACGGGCACGCTGCTGGCCACCGACCTCAACAGCCTGCCCGAGGAA
  GACCAGAAGGGCCTGGGCCGCTCGCTGGAGACGCTGACCGCTGCCGAGGCCACTGCCTTC
  GAGCGCAACGCCCGCACAGAATCCGCCAAATCCACACCCCTGCACAAACTTCGCGACGTG
  ATCATGGAGACCCCCCTGGAGATCACAGAGCTGTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001171935
• ORF Size: 756 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001171935.1, NP_001165406.1
• RefSeq Size: 1844
• RefSeq ORF: 756
• Locus ID: 64072
• Protein Families: Transmembrane
• Gene Summary: This gene is a member of the cadherin superfamily, whose genes encode calcium dependent cell-cell adhesion glycoproteins. The encoded protein is thought to be involved in stereocilia organization and hair bundle formation. The gene is located in a region containing the human deafness loci DFNB12 and USH1D. Usher syndrome 1D and nonsyndromic autosomal recessive deafness DFNB12 are caused by allelic mutations of this cadherin-like gene. Upregulation of this gene may also be associated with breast cancer. Alternative splice variants encoding different isoforms have been described. [provided by RefSeq, May 2013]
  Transcript Variant: This variant (8) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (8, also referred to as isoform C1) has a distinct N-terminus and is shorter than isoform 1.