ELOVL5 (NM_001242831) Human Untagged Clone

CAT#: SC330025

ELOVL5 (untagged) - Homo sapiens ELOVL fatty acid elongase 5 (ELOVL5), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ELOVL5
• Synonyms: dJ483K16.1; HELO1; SCA38
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001242831, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAACATTTTGATGCATCACTTAGTACCTATTTCAAGGCATTGCTAGGCCCTCGAGGTATCAGCAGCT
  CTGTCCTCAGAATGGGTCCCCCACTTCACACAGTTGTAGGATGGCTACAGCAGCTCCAAGCAGCACATTC
  AGAGGAAGAAGAAAAAATGTTTCATTTGTGTGGTTTTAAGCATAAAGAAGTTGTTTCCCAGAGCTCTTTG
  CCAGCTGTCATCCCTCAAAACTCACTGGCCACAATTGCTTCACATGCCCCTGCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001242831
• ORF Size: 267 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001242831.1, NP_001229760.1
• RefSeq Size: 849
• RefSeq ORF: 267
• Locus ID: 60481
• Protein Families: Transmembrane
• Protein Pathways: Biosynthesis of unsaturated fatty acids
• Gene Summary: This gene belongs to the ELO family. It is highly expressed in the adrenal gland and testis, and encodes a multi-pass membrane protein that is localized in the endoplasmic reticulum. This protein is involved in the elongation of long-chain polyunsaturated fatty acids. Mutations in this gene have been associated with spinocerebellar ataxia-38 (SCA38). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
  Transcript Variant: This variant (4) lacks several 3' exons and contains a novel 3' terminal exon compared to variant 1. The resulting isoform (4) is shorter with a distinct C-terminus compared to isoform 1.