WDR4 (NM_001260475) Human Untagged Clone

CAT#: SC332728

WDR4 (untagged) - Homo sapiens WD repeat domain 4 (WDR4), transcript variant 4

Product Images

Circular map for SC332728

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: WDR4
• Synonyms: GAMOS6; hWH; MIGSB; TRM82; TRMT82; Wuho
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001260475, the custom clone sequence may differ by one or more nucleotidesGCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGCTGTTAGATGTGGCTGTGAGTCCTGATGACCGCTTCATCCTCACTGCCGACCGGGACGAGAAGATC
  CGAGTCAGCTGGGCCGCGGCGCCCCATAGCATCGAGTCCTTCTGCTTGGGGCACACAGAGTTTGTGAGC
  CGTATCTCCGTGGTGCCAACTCAGCCCGGGCTGCTTCTGTCCTCCTCTGGGGACGGCACCCTGAGGCTC
  TGGGAGTACAGGAGCGGCCGCCAGCTGCACTGCTGTCACCTGGCCAGTCTGCAGGAGCTGGTGGACCCC
  CAGGCCCCCCAGAAGTTTGCCGCGTCCAGGATTGCATTCTGGTGCCAGGAGAACTGCGTGGCGCTCCTG
  TGCGACGGCACTCCTGTGGTCTACATCTTCCAGCTGGACGCCCGCAGACAGCAGTTGGTGTACAGGCAG
  CAGCTGGCGTTCCAGCACCAAGTGTGGGACGTGGCTTTCGAGGAGACCCAGGGGCTGTGGGTGCTCCAG
  GACTGCCAGGAAGCCCCCCTGGTGCTCTACAGGCCTGTGGGCGACCAGTGGCAGTCTGTTCCTGAGAGC
  ACCGTGTTAAAGAAAGTCTCTGGTGTTCTTCGTGGGAACTGGGCCATGCTGGAAGGCTCTGCCGGCGCA
  GACGCCAGCTTCAGCAGTCTCTACAAGGCCACGTTCGACAACGTGACCTCCTACCTGAAGAAGAAAGAG
  GAGAGACTGCAGCAGCAGCTAGAGAAGAAGCAGCGGCGCCGGAGTCCCCCGCCTGGGCCCGACGGGCAT
  GCCAAGAAGATGAGACCGGGGGAGGCGACGCTAAGTTGCTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001260475
• Insert Size: 801 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001260475.2
• RefSeq Size: 2054 bp
• RefSeq ORF: 801 bp
• Locus ID: 10785
• UniProt ID: P57081
• Cytogenetics: 21q22.3
• MW: 29.9 kDa
• Gene Summary: This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This gene is excluded as a candidate for a form of nonsyndromic deafness (DFNB10), but is still a candidate for other disorders mapped to 21q22.3 as well as for the development of Down syndrome phenotypes. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]
  Transcript Variant: This variant (4) uses an alternate donor splice site at an exon in the 5' region compared to variant 1, resulting in translation initiation from an in-frame downstream AUG and an isoform (3) with a shorter N-terminus compared to isoform 1. Variants 4-6 encode the same isoform.