PEA15 (NM_001297578) Human Untagged Clone

CAT#: SC333563

PEA15 (untagged) - Human phosphoprotein enriched in astrocytes 15 (PEA15), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PEA15
• Synonyms: HMAT1; HUMMAT1H; MAT1; MAT1H; PEA-15; PED; PED-PEA15; PED/PEA15
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001297578, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTGAGTACGGGACCCTCCTGCAAGACCTGACCAACAACATCACCCTTGAAGATCTAGAACAGCTCA
  AGTCGGCCTGCAAGGAAGACATCCCCAGCGAAAAGAACAACCTCTCCTACATTGAGCACATCTTTGAGAT
  CTCCCGCCGTCCTGACCTACTCACTATGGTGGTTGACTACAGAACCCGTGTGCTGAAGATCTCTGAGGAG
  GATGAGCTGGACACCAAGCTAACCCGTATCCCCAGTGCCAAGAAGTACAAAGACATTATCCGGCAGCCCT
  CTGAGGAAGAGATCATCAAATTGGCTCCCCCACCGAAGAAGGCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001297578
• ORF Size: 327 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001297578.1, NP_001284507.1
• RefSeq Size: 2443
• RefSeq ORF: 327
• Locus ID: 8682
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a death effector domain-containing protein that functions as a negative regulator of apoptosis. The encoded protein is an endogenous substrate for protein kinase C. This protein is also overexpressed in type 2 diabetes mellitus, where it may contribute to insulin resistance in glucose uptake. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
  Transcript Variant: This variant (4) lacks two alternate exons and uses an alternate in-frame splice site in the 5' region, compared to variant 1. It initiates translation at a downstream in-frame start codon. The encoded isoform (c) is shorter than isoform a.