ISG20 (NM_001303236) Human Untagged Clone

CAT#: SC334136

ISG20 (untagged) - Human interferon stimulated exonuclease gene 20kDa (ISG20), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ISG20
• Synonyms: CD25; HEM45
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334136 representing NM_001303236.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGAAACTATCAGGTGTGAGGAGGGTCCTAGTGCAATCTCTTCTTTTCAAAGATGATACATTTGAAGCC
  CAGGGAGGACTGATAATTTGCCCAAGGTCACACAGCCAGTCAAGGAGGGATTGCTCCCTTGCCAGCCCC
  AGCCCCACCCAGAAGATGCTGGGTCATGTAGGGGTGGGCACATGTCTTCCTGGCCAGATCCTGCAGCTC
  CTGAAAGGCAAGCTGGTGGTGGGTCATGACCTGAAGCACGACTTCCAGGCACTGAAAGAGGACATGAGC
  GGCTACACAATCTACGACACGTCCACTGACAGGCTGTTGTGGCGTGAGGCCAAGCTGGACCACTGCAGG
  CGTGTCTCCCTGCGGGTGCTGAGTGAGCGCCTCCTACACAAGAGCATCCAGAACAGCCTGCTTGGACAC
  AGCTCGGTGGAAGATGCGAGGGCAACGATGGAGCTCTATCAAATCTCCCAGAGAATCCGAGCCCGCCGA
  GGGCTGCCCCGCCTGGCTGTGTCAGACTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001303236
• Insert Size: 513 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001303236.1
• RefSeq Size: 3694 bp
• RefSeq ORF: 513 bp
• Locus ID: 3669
• UniProt ID: Q96AZ6
• Cytogenetics: 15q26.1
• MW: 19.1 kDa
• Gene Summary: Interferon-induced antiviral exoribonuclease that acts on single-stranded RNA and also has minor activity towards single-stranded DNA. Exhibits antiviral activity against RNA viruses including hepatitis C virus (HCV), hepatitis A virus (HAV) and yellow fever virus (YFV) in an exonuclease-dependent manner. May also play additional roles in the maturation of snRNAs and rRNAs, and in ribosome biogenesis.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (5) uses an alternate splice junction at the 5' end of an internal exon, resulting in translation initiation at an alternate start codon compared to variant 1. The encoded isoform (b) has a shorter and distinct N-terminus compared to isoform a. Variants 4 and 5 both encode the same isoform (b). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.