Calcipressin 1 (RCAN1) (NM_001285389) Human Untagged Clone

CAT#: SC334144

RCAN1 (untagged) - Human regulator of calcineurin 1 (RCAN1), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RCAN1
• Synonyms: ADAPT78; CSP1; DSC1; DSCR1; MCIP1; RCN1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334144 representing NM_001285389.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGTGTATGCCAAATTTGAGTCCCTCTTTAGGACGTATGACAAGGACATCACCTTTCAGTATTTTAAG
  AGCTTCAAACGAGTCAGAATAAACTTCAGCAACCCCTTCTCCGCAGCAGATGCCAGGCTCCAGCTGCAT
  AAGACTGAGTTTCTGGGAAAGGAAATGAAGTTATATTTTGCTCAGACCTTACACATAGGAAGCTCACAC
  CTGGCTCCGCCAAATCCAGACAAGCAGTTTCTGATCTCCCCTCCCGCCTCTCCGCCAGTGGGATGGAAA
  CAAGTGGAAGATGCGACCCCAGTCATAAACTATGATCTCTTATATGCCATCTCCAAGCTGGGGCCAGGG
  GAAAAGTATGAATTGCACGCAGCGACTGACACCACTCCCAGCGTGGTGGTCCATGTATGTGAGAGTGAT
  CAAGAGAAGGAGGAAGAAGAGGAAATGGAAAGAATGAGGAGACCTAAGCCAAAAATTATCCAGACCAGG
  AGGCCGGAGTACACGCCGATCCACCTCAGCTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001285389
• Insert Size: 516 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001285389.2
• RefSeq Size: 2210 bp
• RefSeq ORF: 516 bp
• Locus ID: 1827
• UniProt ID: P53805
• Cytogenetics: 21q22.12
• Protein Families: Transcription Factors
• MW: 19.8 kDa
• Gene Summary: The protein encoded by this gene interacts with calcineurin A and inhibits calcineurin-dependent signaling pathways, possibly affecting central nervous system development. This gene is located in the minimal candidate region for the Down syndrome phenotype, and is overexpressed in the brain of Down syndrome fetuses. Chronic overexpression of this gene may lead to neurofibrillary tangles such as those associated with Alzheimer disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
  Transcript Variant: This variant (4) uses an alternate 5' exon compared to variant 1. The resulting isoform (d) has a distinct N-terminus compared to isoform a.