GNLY (NM_001302758) Human Untagged Clone

CAT#: SC334157

GNLY (untagged) - Human granulysin (GNLY), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GNLY
• Synonyms: D2S69E; LAG-2; LAG2; NKG5; TLA519
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334157 representing NM_001302758.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCTACCTGGGCCCTCCTGCTCCTTGCAGCCATGCTCCTGGGCAACCCAGGCCTTGAGGTCAGTGTG
  AGCCCCAAGGGCAAGAACACTTCTGGAAGGGAGAGTGGATTTGGCTGGGCCATCTGGATGGAAGGTCTG
  GTCTTCTCTCGTCTGAGCCCTGAGTACTACGACCTGGCAAGAGCCCACCTGCGTGATGAGGAGAAATCC
  TGCCCGTGCCTGGCCCAGGAGGGCCCCCAGGGTGACCTGTTGACCAAAACACAGGAGCTGGGCCGTGAC
  TACAGGACCTGTCTGACGATAGTCCAAAAACTGAAGAAGATGGTGGATAAGCCCACCCAGAGAAGTGTT
  TCCAATGCTGCGACCCGGGTGTGTAGGACGGGGAGGTCACGATGGCGCGACGTCTGCAGAAATTTCATG
  AGGAGGTATCAGTCTAGAGTTACCCAGGGCCTCGTGGCCGGAGAAACTGCCCAGCAGATCTGTGAGGAC
  CTCAGGTTGTGTATACCTTCTACAGGTCCCCTCTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001302758
• Insert Size: 519 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001302758.1
• RefSeq Size: 924 bp
• RefSeq ORF: 519 bp
• Locus ID: 10578
• UniProt ID: P22749
• Cytogenetics: 2p11.2
• Protein Families: Secreted Protein
• MW: 19.3 kDa
• Gene Summary: The product of this gene is a member of the saposin-like protein (SAPLIP) family and is located in the cytotoxic granules of T cells, which are released upon antigen stimulation. This protein is present in cytotoxic granules of cytotoxic T lymphocytes and natural killer cells, and it has antimicrobial activity against M. tuberculosis and other organisms. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (1) encodes the longest isoform (1).