Uridine Phosphorylase 1 (UPP1) (NM_001287428) Human Untagged Clone

CAT#: SC334165

UPP1 (untagged) - Human uridine phosphorylase 1 (UPP1), transcript variant 4


  "NM_001287428" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Rabbit Polyclonal Anti-UPP1 Antibody
    • 100 ul

USD 475.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "UPP1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol UPP1
Synonyms UDRPASE; UP; UPASE; UPP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334165 representing NM_001287428.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAGAGAAAGCTGAAAGTCACAAGTCTGGAGCCCGGCACTGTGGTCATAACAGAGCAGGCAGTGGAT
ACCTGCTTCAAGGCAGAGTTTGAGCAGATTGTCCTGGGGAAGCGGGTCATCCGGAAAACGGACCTTAAC
AAGAAGCTGGTGCAGGAGCTGTTGCTGTGTTCTGCAGAGCTGAGCGAGTTCACCACAGTGGTGGGGAAC
ACCATGTGCACCTTGGACTTCTATGAAGGGCAAGGCCGTCTGGATGGGGCTCTCTGCTCCTACACGGAG
AAGGACAAGCAGGCGTATCTGGAGGCAGCCTATGCAGCCGGCGTCCGCAATATCGAGATGGAGTCCTCG
GTGTTTGCCGCCATGTGCAGCGCCTGCGGCCTCCAAGCGGCCGTGGTGTGTGTCACCCTCCTGAACCGC
CTGGAAGGGGACCAGATCAGCAGCCCTCGCAATGTGCTCAGCGAGTACCAGCAGAGGCCGCAGCGGCTG
GTGAGCTACTTCATCAAGAAGAAACTGAGCAAGGCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001287428
Insert Size 522 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001287428.1
RefSeq Size 1587 bp
RefSeq ORF 522 bp
Locus ID 7378
UniProt ID Q16831
Cytogenetics 7p12.3
Protein Pathways Drug metabolism - other enzymes, Metabolic pathways, Pyrimidine metabolism
MW 19.2 kDa
Gene Summary This gene encodes a uridine phosphorylase, an enzyme that catalyzes the reversible phosphorylation of uridine (or 2'- deoxyuridine) to uracil and ribose-1-phosphate (or deoxyribose-1-phosphate). The encoded enzyme functions in the degradation and salvage of pyrimidine ribonucleosides. [provided by RefSeq, Oct 2016]
Transcript Variant: This variant (4) differs in the 5' UTR, lacks three exons in the 5' coding region and initiates translation at an alternate start codon, compared to variant 8. The encoded isoform (b) has a distinct N-terminus and is shorter than isoform a. Variants 4, 5 and 6 all encode isoform b.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.