BOULE (BOLL) (NM_001284358) Human Untagged Clone
CAT#: SC334178
BOLL (untagged) - Human boule-like RNA-binding protein (BOLL), transcript variant 3
"NM_001284358" in other vectors (1)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | BOLL |
Synonyms | BOULE |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC334178 representing NM_001284358.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGACAGAGCTGGAGTATCCAAAGGGTTCTAGTATAATGCCAGCAGCTGGAACAATGTATCTAACAACT TCAACTGGATATCCTTATACTTACCATAATGGTGTTGCTTATTTTCATACTCCAGAGGTAACTTCGGTC CCACCGCCTTGGCCTTCACGTTCTGTATGTAGCTCCCCTGTGATGGTAGCTCAGCCCATTTATCAGCAA CCTGCATATCACTACCAGGCCACCACACAGTATTTACCAGGACAGTGGCAGTGGAGTGTTCCTCAGCCT TCTGCCTCTTCTGCTCCATTCTTATACCTGCAACCTTCTGAGGTTATTTATCAACCAGTGGAAATTGCA CAGGATGGTGGATGTGTTCCTCCTCCACTGTCTCTGATGGAAACTTCAGTTCCAGAGCCTTATTCTGAT CATGGAGTTCAAGCAACATATCACCAGGTTTATGCTCCAAGTGCCATCACTATGCCTGCGCCTGTGATG CAGCCTGAGCCAATTAAAACAGTGTGGAGCATTCATTATTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites |
SgfI-MluI
Plasmid Map
![]() |
ACCN | NM_001284358 |
Insert Size | 525 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001284358.1 |
RefSeq Size | 2742 bp |
RefSeq ORF | 525 bp |
Locus ID | 66037 |
UniProt ID | Q8N9W6 |
Cytogenetics | 2q33.1 |
MW | 19.3 kDa |
Gene Summary | This gene belongs to the DAZ gene family required for germ cell development. It encodes an RNA-binding protein which is more similar to Drosophila Boule than to human proteins encoded by genes DAZ (deleted in azoospermia) or DAZL (deleted in azoospermia-like). Loss of this gene function results in the absence of sperm in semen (azoospermia). Histological studies demonstrated that the primary defect is at the meiotic G2/M transition. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) differs in the 5' UTR and lacks two consecutive exons in the 5' coding region and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (3) is shorter and has a distinct N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236284 | BOLL (myc-DDK-tagged) - Human boule-like RNA-binding protein (BOLL), transcript variant 3 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review