Ikaros (IKZF1) (NM_001291845) Human Untagged Clone

CAT#: SC334179

IKZF1 (untagged) - Human IKAROS family zinc finger 1 (Ikaros) (IKZF1), transcript variant 15


  "NM_001291845" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
IKZF1 Rabbit Polyclonal Antibody
    • 100 ul

USD 275.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "IKZF1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol IKZF1
Synonyms CVID13; Hs.54452; IK1; IKAROS; LyF-1; LYF1; PPP1R92; PRO0758; ZNFN1A1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334179 representing NM_001291845.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGATGCTGATGAGGGTCAAGACATGTCCCAAGTTTCAGGGAAGGAAAGCCCCCCTGTAAGCGATACT
CCAGATGAGGGCGATGAGCCCATGCCGATCCCCGAGGACCTCTCCACCACCTCGGGAGGACAGCAAAGC
TCCAAGAGTGACAGAGTCGTGGTTACATATGGGGCTGATGACTTTAGGGATTTCCATGCAATAATTCCC
AAATCTTTCTCTCGTAAGTATATGCCTTGCTTCTGGAAAACAAAAGCATGCCTTCATCTCCTATCATGT
AAATATCGTACGTGCATGTTCCTTCATCAACCCCCGAGATACATTAAATATTCACTGTTCTATTCGTTA
GACACCTACCATATCATTTTTGGGTATTTATACCATAAAGTGCAAAACGAAGGTCTAGGCAGTTGTGCG
GTGTCCTGGGAGCATGGCAGTGGAGTAACAGTAAGGGTTGGAGTCACAGTAGCACTGATGGGATTGTTA
CTTCGCAGATGCTGCTGGACAGCTTTGAGATTACTCCTGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001291845
Insert Size 525 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001291845.1
RefSeq Size 1896 bp
RefSeq ORF 525 bp
Locus ID 10320
Cytogenetics 7p12.2
Protein Families Druggable Genome, Transcription Factors
MW 19.6 kDa
Gene Summary This gene encodes a transcription factor that belongs to the family of zinc-finger DNA-binding proteins associated with chromatin remodeling. The expression of this protein is restricted to the fetal and adult hemo-lymphopoietic system, and it functions as a regulator of lymphocyte differentiation. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. Most isoforms share a common C-terminal domain, which contains two zinc finger motifs that are required for hetero- or homo-dimerization, and for interactions with other proteins. The isoforms, however, differ in the number of N-terminal zinc finger motifs that bind DNA and in nuclear localization signal presence, resulting in members with and without DNA-binding properties. Only a few isoforms contain the requisite three or more N-terminal zinc motifs that confer high affinity binding to a specific core DNA sequence element in the promoters of target genes. The non-DNA-binding isoforms are largely found in the cytoplasm, and are thought to function as dominant-negative factors. Overexpression of some dominant-negative isoforms have been associated with B-cell malignancies, such as acute lymphoblastic leukemia (ALL). [provided by RefSeq, May 2014]
Transcript Variant: This variant (15) lacks five 3' exons but contains an alternate 3' terminal exon, and it thus differs in its 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (15) has a distinct C-terminus and is significantly shorter than isoform 1. This isoform contains no N-terminal zinc finger motifs and is likely non-DNA-binding.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.