TMIGD3 (NM_001302680) Human Untagged Clone

CAT#: SC334199

TMIGD3 (untagged) - Human transmembrane and immunoglobulin domain containing 3 (TMIGD3), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TMIGD3
• Synonyms: AD026
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334199 representing NM_001302680.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGAAGGGTCTCCAGCAGGACCCATTGAGCAGAAGGAGGCCAGGTGGGAAAGCTCCTGGGAAGAGCAG
  CCAGACTGGACACTGGGCTGCTTGAGTCCTGAGTCACACACCAATCATGTGGCCCTGAGGGACACAGGG
  AACCAGCTCATTGTCACTATGTCCTGCCTGACCAAAGAGGACACGGGCTGGTACTGGTGTGGCATCCAG
  CGGGACTTTGCCAGGGATGACATGGATTTTACAGAGCTGATTGTAACTGACGACAAAGGAACCCTGGCC
  AATGACTTTTGGTCTGGGAAAGACCTATCAGGCAACAAAACCAGAAGCTGCAAGGCTCCCAAAGTTGTC
  CGCAAGGCTGACCGCTCCAGGACGTCCATTCTCATCATTTGCATACTGATCACGGGTTTGGGAATCATC
  TCTGTAATCAGTCATTTGACCAAAAGGAGGAGAAGTCAAAGGAATAGAAGGGTAGGCAACACTTTGAAG
  CCCTTCTCGCGTGTCCTGACTCCAAAGGAAATGGCTCCTACTGAACAGATGTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001302680
• Insert Size: 537 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001302680.1
• RefSeq Size: 949 bp
• RefSeq ORF: 537 bp
• Locus ID: 57413
• UniProt ID: P33765
• Cytogenetics: 1p13.2
• MW: 20.2 kDa
• Gene Summary: This gene encodes a transmembrane and immunoglobulin domain-containing protein. Alternative splicing results in multiple transcript variants, one of which shares its 5' terminal exon with that of the overlapping adenosine A3 receptor gene (GeneID:140), thus resulting in a fusion product. [provided by RefSeq, Nov 2014]
  Transcript Variant: This variant (4) contains an alternate 5' terminal exon, lacks an internal exon and uses an alternate splice site in another exon, thus resulting in an alternate 5' UTR and 5' coding region, compared to variant 1. The encoded isoform (4) has a distinct N-terminus and is shorter than isoform 1, and it does not share any similarity with the adenosine A3 receptor.