TMEM9 (NM_001288567) Human Untagged Clone

CAT#: SC334251

TMEM9 (untagged) - Human transmembrane protein 9 (TMEM9), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TMEM9
• Synonyms: DERM4; TMEM9A
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC334251 representing NM_001288567.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGAAGCTCTTATCTTTGGTGGCTGTGGTCGGGTGTTTGCTGGTGCCCCCAGCTGAAGCCAACAAGAGT
  TCTGAAGATATCCGGTGCAAATGCATCTGTCCACCTTATAGAAACATCAGTGGGCACATTTACAACCAG
  AATGTATCCCAGAAGGACTGCAACTGCCTGCACGTGGTGGAGCCCATGCCAGTGCCTGGCCATGACGTG
  GAGGCCTACTGCCTGCTGTGCGAGTGCAGGTACGAGGAGCGCAGCACCACCACCATCAAGGTCATCATT
  GTCATCTACCTGTCCGTGGTGGGTGCCCTGTTGCTCTACATGGCCTTCCTGATGCTGGTGGACCCTCTG
  ATCCGAAAGCCGGATGCATATACTGAGCAACTGCACAATGAGGAGGAGAATGAGGATGCTCGCTCTATG
  GCAGCAGCTGCTGCATCCCTCGGGGGACCCCGAGCAAACACAGTCCTGGAGCGTGTGGAAGGTGCCCAG
  CAGCGGTGGAAGCTGCAGGTGCAGGAGCAGCGGAAGACAGTCTTCGATCGGCACAAGATGCTCAGCTAG
  
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001288567
• Insert Size: 552 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001288567.1
• RefSeq Size: 1905 bp
• RefSeq ORF: 552 bp
• Locus ID: 252839
• UniProt ID: Q9P0T7
• Cytogenetics: 1q32.1
• Protein Families: Transmembrane
• MW: 20.6 kDa
• Gene Summary: May be involved in intracellular transport.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (5) differs in the 5' UTR, compared to variant 1. Variants 1-7 encode the same isoform (a).