CLRN1 (NM_001256819) Human Untagged Clone

CAT#: SC334273

CLRN1 (untagged) - Human clarin 1 (CLRN1), transcript variant 6

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CLRN1
• Synonyms: RP61; USH3; USH3A
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334273 representing NM_001256819.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGCCAAGCCAACAGAAGAAAATCATTTTTTGCATGGCCGGAGTGTTCAGTTTTGCATGTGCCCTCGGA
  GTTGTGACAGCCTTGGGGACACCGTTGTGGATCAAAGCCACTGTCCTCTGCAAAACGGGAGCTCTGCTC
  GTCAATGCCTCAGGGCAGGAGCTGGACAAGTTTATGGGTGAAATGCAGTACGGGCTTTTCCACGGAGAG
  GGTGTGAGGCAGTGTGGGTTGGGAGCAAGGCCCTTTCGGTTCTCATGCTATTTTCTTGACCCCTTCATG
  GGACTCCCAACAGGGGTACCCCATTTACTCAGCCTGCCCTGCTCAACCTCTTGCAGGAGGGAGCACACG
  AGTGAACGAGTGCAGGAACCAGCTGGCTGCTTTAGTGCTGTGAGGAGTAAACTCCATGCAGGCCCTGCA
  GCAGCAACCAGTTTTTCCAGATTTGCTCAAAGCAATCCCAGTGAGCATCCACGTCAATGTCATTCTCTT
  CTCTGCCATCCTTATTGTGTTAACCATGGTGGGGACAGCCTTCTTCATGTACAATGCTTTTGGAAAACC
  TTTTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001256819
• Insert Size: 558 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001256819.1
• RefSeq Size: 2531 bp
• RefSeq ORF: 558 bp
• Locus ID: 7401
• Cytogenetics: 3q25.1
• Protein Families: Transmembrane
• MW: 20.2 kDa
• Gene Summary: This gene encodes a protein that contains a cytosolic N-terminus, multiple helical transmembrane domains, and an endoplasmic reticulum membrane retention signal, TKGH, in the C-terminus. The encoded protein may be important in development and homeostasis of the inner ear and retina. Mutations within this gene have been associated with Usher syndrome type IIIa. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (6) has multiple differences in the coding region, compared to variant 5, one of which results in a translational frameshift. The resulting isoform (e) has a distinct C-terminus and is shorter than isoform d. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.