NQO2 (NM_001290222) Human Untagged Clone

CAT#: SC334357

NQO2 (untagged) - Human NAD(P)H dehydrogenase, quinone 2 (NQO2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NQO2
• Synonyms: DHQV; DIA6; NMOR2; QR2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334357 representing NM_001290222.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCAGGTAAGAAAGTACTCATTGTCTATGCACACCAGGAACCCAAGTCTTTCAACGGATCCTTGAAG
  AATGTGGCTGTAGATGAACTGAGCAGGCAGGGCTGCACCGTCACAGTGTCTGATTTGTATGCCATGAAC
  CTTGAGCCGAGGGCCACAGACAAAGATATCACTGGTACTCTTTCTAATCCTGAGGTTTTCAATTATGGA
  GTGGAAACCCACGAAGCCTACAAGCAAAGGTCTCTGGCTAGCGACATCACTGATGAGCAGAAAAAGGTT
  CGGGAGGCTGACCTAGTGATATTTCAGGGTAAACTAGCGCTCCTTTCCGTAACCACGGGAGGCACGGCC
  GAGATGTACACGAAGACAGGAGTCAATGGAGATTCTCGATACTTCCTGTGGCCACTCCAGCATGGCACA
  TTACACTTCTGTGGATTTAAAGTCCTTGCCCCTCAGATCAGCTTTGCTCCTGAAATTGCATCCGAAGAA
  GAAAGAAAGGGGATGGTGGCTGCGTGGTCCCAGAGGCTGCAGACCATCTGGAAGGAAGAGCCCATCCCC
  TGCACAGCCCACTGGCACTTCGGGCAATAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001290222
• Insert Size: 582 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001290222.1
• RefSeq Size: 1158 bp
• RefSeq ORF: 582 bp
• Locus ID: 4835
• Cytogenetics: 6p25.2
• MW: 21.5 kDa
• Gene Summary: This gene encodes a member of the thioredoxin family of enzymes. It is a cytosolic and ubiquitously expressed flavoprotein that catalyzes the two-electron reduction of quinone substrates and uses dihydronicotinamide riboside as a reducing coenzyme. Mutations in this gene have been associated with neurodegenerative diseases and several cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
  Transcript Variant: This variant (2) lacks three exons in the 5' UTR and lacks an alternate in-frame exon in the coding region compared to variant 1. The encoded protein (isoform 2) is shorter, compared to isoform 1.