PDK2 (NM_001199900) Human Untagged Clone

CAT#: SC334402

PDK2 (untagged) - Human pyruvate dehydrogenase kinase, isozyme 2 (PDK2), transcript variant 4


  "NM_001199900" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Rabbit Polyclonal Antibody against PDK2 (C-term)
    • 100 ug

USD 450.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "PDK2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PDK2
Synonyms PDHK2; PDKII
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334402 representing NM_001199900.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCGCTGGGTGTGGGCGCTGCTGAAGAATGCGTCCCTGGCAGGGGCGCCCAAGTACATAGAGCACTTC
AGCAAGTTCTCCCCGTCCCCGCTGTCCATGAAGCAGTTTCTGGACTTCGGATCCAGCAATGCCTGTGAG
AAAACCTCCTTCACCTTCCTCAGGCAGGAGCTGCCTGTGCGCCTGGCCAACATCATGAAAGAGATCAAC
CTGCTTCCCGACCGAGTGCTGAGCACACCCTCCGTGCAGCTGGTGCAGAGCTGGTATGTCCAGAGCCTC
CTGGACATCATGGAGTTCCTGGACAAGGATCCCGAGGACCATCGCACCCTGAGCCAGTTCACTGACGCC
CTGGTCACCATCCGGAACCGGCACAACGACGTGGTGCCCACCATGGCACAAGGCGTGCTTGAGTACAAG
GACACCTACGGCGATGACCCCGTCTCCAACCAGAACATCCAGTACTTCCTGGACCGCTTCTACCTCAGC
CGCATCTCCATCCGCATGCTCATCAACCAGCACAGTGGGTGCCGGCCACAGCGGCGGGGAGCGGGCGGT
GGGGGGGGCGGTGCTGGGGCCCAGGGCCGGGCTGCTGAGGGGACCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001199900
Insert Size 600 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001199900.1
RefSeq Size 987 bp
RefSeq ORF 600 bp
Locus ID 5164
Cytogenetics 17q21.33
Protein Families Druggable Genome, Protein Kinase
MW 22.4 kDa
Gene Summary This gene encodes a member of the pyruvate dehydrogenase kinase family. The encoded protein phosphorylates pyruvate dehydrogenase, down-regulating the activity of the mitochondrial pyruvate dehydrogenase complex. Overexpression of this gene may play a role in both cancer and diabetes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (4) lacks a splice site in the 3' coding region, compared to variant 1. This results in a shorter protein with a distinct C-terminus (isoform 3), compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.