MEMO1 (NM_001301852) Human Untagged Clone

CAT#: SC334419

MEMO1 (untagged) - Human mediator of cell motility 1 (MEMO1), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MEMO1
• Synonyms: C2orf4; CGI-27; MEMO; NS5ATP7
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334419 representing NM_001301852.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGCAGGATATACGTACTGTGGGTCTTGTGCTGCCCATGCTTATAAACAAGTGGATCCGTCTATTACCC
  GGAGAATTTTCATCCTTGGGCCTTCTCATCATGTGCCCCTCTCTCGATGTGCACTTTCCAGTGTGGATA
  TATATAGGACACCTCTGTATGACCTTCGTATTGACCAAAAGATTTACGGAGAACTGTGGAAGACAGGAA
  TGTTTGAACGCATGTCTCTGCAGACAGATGAAGATGAACACAGTATTGAAATGCATTTGCCTTATACAG
  CTAAAGCCATGGAAAGGTCAAAGGTTCCGTTACAGTTACTATGATGAATCCCAGGGGGAGATTTATAGA
  TCCATTGAACATCTAGATAAAATGGGTATGAGTATTATAGAACAATTAGACCCTGTATCTTTTAGCAAT
  TACTTGAAGAAATACCATAATACTATATGTGGAAGACATCCCATTGGGGTGTTATTAAATGCTATCACA
  GAGCTCCAGAAGAATGGAATGAATATGAGTTTTTCGTTTTTGAATTATGCCCAGTCGAGCCAGTGTAGA
  AACTGGCAAGACAGTTCAGTGAGTTATGCAGCTGGAGCACTCACGGTCCACTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001301852
• Insert Size: 606 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001301852.1
• RefSeq Size: 1368 bp
• RefSeq ORF: 606 bp
• Locus ID: 51072
• UniProt ID: Q9Y316
• Cytogenetics: 2p22.3
• MW: 23.2 kDa
• Gene Summary: May control cell migration by relaying extracellular chemotactic signals to the microtubule cytoskeleton. Mediator of ERBB2 signaling. The MEMO1-RHOA-DIAPH1 signaling pathway plays an important role in ERBB2-dependent stabilization of microtubules at the cell cortex. It controls the localization of APC and CLASP2 to the cell membrane, via the regulation of GSK3B activity. In turn, membrane-bound APC allows the localization of the MACF1 to the cell membrane, which is required for microtubule capture and stabilization. Is required for breast carcinoma cell migration.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (4) differs in the 5' UTR, has multiple coding region differences, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (3) has a distinct N-terminus and is shorter than isoform 1.