RNASE9 (NM_001289110) Human Untagged Clone

CAT#: SC334446

RNASE9 (untagged) - Human ribonuclease, RNase A family, 9 (non-active) (RNASE9), transcript variant 8

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RNASE9
• Synonyms: h461; HEL128; RAK1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334446 representing NM_001289110.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGATGAGAACTCTCATCACCACACACCCACTGCCCCTGCTTCTATTGCCGCAGCAGCTGCTGCAGCTG
  GTGCAGTTTCAAGAGGTGGATACAGATTTTGATTTCCCAGAAGAAGATAAAAAAGAAGAATTTGAAGAG
  TGTTTGGAAAAATTTTTTAGTACAGGGCCCGCCAGACCACCTACCAAAGAAAAAGTCAAAAGACGTGTC
  CTTATTGAACCTGGAATGCCACTAAATCATATAGAGTACTGTAACCATGAAATCATGGGAAAAAATGTT
  TACTACAAACACCGTTGGGTGGCAGAACATTACTTCCTTCTTATGCAATATGACGAGCTCCAAAAAATC
  TGTTACAACAGATTTGTGCCATGTAAGAATGGAATTAGGAAATGTAACAGGAGCAAAGGTCTTGTAGAA
  GGAGTGTATTGTAATTTAACAGAAGCATTTGAAATACCAGCGTGTAAATACGAATCACTTTATAGGAAG
  GGCTACGTCCTTATCACTTGTTCATGGCAAAATGAAATGCAAAAACGTATTCCTCATACTATAAATGAT
  CTCGTGGAGCCACCTGAACACAGAAGTTTCCTCAGTGAGGATGGTGTCTTTGTCATATCGCCCTAG
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001289110
• Insert Size: 618 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001289110.1
• RefSeq Size: 1155 bp
• RefSeq ORF: 618 bp
• Locus ID: 390443
• UniProt ID: P60153
• Cytogenetics: 14q11.2
• Protein Families: Secreted Protein
• MW: 24.3 kDa
• Gene Summary: Does not exhibit any ribonuclease activity.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (8) lacks an alternate exon in the 5' region and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus than isoform 1. Variants 5, 6, 7, and 8 encode the same isoform (2).