TMBIM4 (NM_001282610) Human Untagged Clone

CAT#: SC334468

TMBIM4 (untagged) - Human transmembrane BAX inhibitor motif containing 4 (TMBIM4), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TMBIM4
• Synonyms: CGI-119; GAAP; LFG4; S1R; ZPRO
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334468 representing NM_001282610.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCAGCAGCGTGGCCTCCGCCACCGTGCACATCCGAATGGGTTCTCTTAACTACAGTGACTTCAACA
  GTTTTTTTATACTTTGAGTCTGTACGGACATTTGTACATGAGAGTCCTGCCTTAATTTTGCTGTTTGCC
  CTCGGATCTCTGGGTTTGATTTTTGCGTTGATTTTAAACAGACATAAGTATCCCCTTAACCTGTACCTA
  CTTTTTGGATTTACGCTGTTGGAAGCTCTGACTGTGGCAGTTGTTGTTACTTTCTATGATGTATATATT
  ATTCTGCAAGCTTTCATACTGACTACTACAGTATTTTTTGGTTTGACTGTGTATACTCTACAATCTAAG
  AAGGATTTCAGCAAATTTGGAGCAGGGCTGTTTGCTCTTTTGTGGATATTGTGCCTGTCAGGATTCTTG
  AAGTTTTTTTTTTATAGTGAGATAATGGAGTTGGTCTTAGCCGCTGCAGGAGCCCTTCTTTTCTGTGGA
  TTCATCATCTATGACACACACTCACTGATGCATAAACTGTCACCTGAAGAGTACGTATTAGCTGCCATC
  AGCCTCTACTTGGATATCATCAATCTATTCCTGCACCTGTTACGGTTTCTGGAAGCAGTTAATAAAAAG
  TAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001282610
• Insert Size: 624 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001282610.1
• RefSeq Size: 1840 bp
• RefSeq ORF: 624 bp
• Locus ID: 51643
• UniProt ID: Q9HC24
• Cytogenetics: 12q14.3
• Protein Families: Transmembrane
• MW: 23.4 kDa
• Gene Summary: Anti-apoptotic protein which can inhibit apoptosis induced by intrinsic and extrinsic apoptotic stimuli. Can modulate both capacitative Ca2+ entry and inositol 1,4,5-trisphosphate (IP3)-mediated Ca2+ release.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (4) uses an alternate splice site in the 5' coding region which results in the use of an alternate translational start codon, compared to variant 1. The encoded isoform (d) has a distinct N-terminus and is shorter than isoform a.