TMBIM4 (NM_001282610) Human Untagged Clone

CAT#: SC334468

TMBIM4 (untagged) - Human transmembrane BAX inhibitor motif containing 4 (TMBIM4), transcript variant 4


  "NM_001282610" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Rabbit polyclonal anti-TMBIM4 antibody
    • 100 ul

USD 345.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "TMBIM4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TMBIM4
Synonyms CGI-119; GAAP; LFG4; S1R; ZPRO
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334468 representing NM_001282610.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCAGCAGCGTGGCCTCCGCCACCGTGCACATCCGAATGGGTTCTCTTAACTACAGTGACTTCAACA
GTTTTTTTATACTTTGAGTCTGTACGGACATTTGTACATGAGAGTCCTGCCTTAATTTTGCTGTTTGCC
CTCGGATCTCTGGGTTTGATTTTTGCGTTGATTTTAAACAGACATAAGTATCCCCTTAACCTGTACCTA
CTTTTTGGATTTACGCTGTTGGAAGCTCTGACTGTGGCAGTTGTTGTTACTTTCTATGATGTATATATT
ATTCTGCAAGCTTTCATACTGACTACTACAGTATTTTTTGGTTTGACTGTGTATACTCTACAATCTAAG
AAGGATTTCAGCAAATTTGGAGCAGGGCTGTTTGCTCTTTTGTGGATATTGTGCCTGTCAGGATTCTTG
AAGTTTTTTTTTTATAGTGAGATAATGGAGTTGGTCTTAGCCGCTGCAGGAGCCCTTCTTTTCTGTGGA
TTCATCATCTATGACACACACTCACTGATGCATAAACTGTCACCTGAAGAGTACGTATTAGCTGCCATC
AGCCTCTACTTGGATATCATCAATCTATTCCTGCACCTGTTACGGTTTCTGGAAGCAGTTAATAAAAAG
TAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001282610
Insert Size 624 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282610.1
RefSeq Size 1840 bp
RefSeq ORF 624 bp
Locus ID 51643
UniProt ID Q9HC24
Cytogenetics 12q14.3
Protein Families Transmembrane
MW 23.4 kDa
Gene Summary Anti-apoptotic protein which can inhibit apoptosis induced by intrinsic and extrinsic apoptotic stimuli. Can modulate both capacitative Ca2+ entry and inositol 1,4,5-trisphosphate (IP3)-mediated Ca2+ release.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) uses an alternate splice site in the 5' coding region which results in the use of an alternate translational start codon, compared to variant 1. The encoded isoform (d) has a distinct N-terminus and is shorter than isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.