SLC9A3R2 (NM_001252076) Human Untagged Clone

CAT#: SC334528

SLC9A3R2 (untagged) - Human solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 2 (SLC9A3R2), transcript variant 5


  "NM_001252076" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Anti-SLC9A3R2 Rabbit Polyclonal Antibody
    • 100 ul

USD 345.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "SLC9A3R2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SLC9A3R2
Synonyms E3KARP; NHE3RF2; NHERF-2; NHERF2; OCTS2; SIP-1; SIP1; TKA-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334528 representing NM_001252076.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCACGCTCCGGGAGTGCCACGCCACCTGCCCGGGCTCCGGGAGCCCCTCCACGGAGCCCACCCCAG
AGGCTGGTACAGGATGTCAGTGGGCCCCTGAGGGAGCTGCGCCCTCGGCTCTGCCACCTGCGAAAGGGA
CCTCAGGGCTATGGGTTCAACCTGCATAGTGACAAGTCCCGGCCCGGCCAGTACATCCGCTCTGTGGAC
CCGGGCTCACCTGCCGCCCGCTCTGGCCTCCGCGCCCAGGACCGGCTCATTGAGGTGAACGGGCAGAAT
GTGGAGGGACTGCGCCATGCTGAGGTGGTGGCCAGCATCAAGGCACGGGAGGACGAGGCCCGGCTGCTG
GTCGTGGACCCCGAGACAGATGAACACTTCAAGCGGCTTCGGGTCACACCCACCGAGGAGCACGTGGAA
GGTCCTCTGCCGTCACCCGTCACCAATGGAACCAGCCCTGCCCAGCTCAATGGTGGCTCTGCGTGCTCG
TCCCGAAGTGACCTGCCTGGTTCCGACAAGGACACTGAGGAGAGCGGCCTCCACCTGAGCCCCACGGCG
GCCGAGGCCAAGGAGAAGGCTCGAGCCATGCGAGTCAACAAGCGCGCGCCACAGATGGACTGGAACAGG
AAGCGTGAAATCTTCAGCAACTTCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001252076
Insert Size 648 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001252076.1
RefSeq Size 1778 bp
RefSeq ORF 648 bp
Locus ID 9351
Cytogenetics 16p13.3
Protein Families Druggable Genome
MW 23.5 kDa
Gene Summary This gene encodes a member of the NHERF family of PDZ scaffolding proteins. These proteins mediate many cellular processes by binding to and regulating the membrane expression and protein-protein interactions of membrane receptors and transport proteins. The encoded protein plays a role in intestinal sodium absorption by regulating the activity of the sodium/hydrogen exchanger 3, and may also regulate the cystic fibrosis transmembrane regulator (CFTR) ion channel. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Transcript Variant: This variant (5) differs in the 5' UTR, uses an alternate splice site in the 3' coding region, lacks a portion of the 5' coding region and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (e) is shorter and has a distinct N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.