SLC9A3R2 (NM_001252075) Human Untagged Clone

CAT#: SC334600

SLC9A3R2 (untagged) - Human solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 2 (SLC9A3R2), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SLC9A3R2
• Synonyms: E3KARP; NHE3RF2; NHERF-2; NHERF2; OCTS2; SIP-1; SIP1; TKA-1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334600 representing NM_001252075.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCACGCTCCGGGAGTGCCACGCCACCTGCCCGGGCTCCGGGAGCCCCTCCACGGAGCCCACCCCAG
  AGGCTGGATGTCAGTGGGCCCCTGAGGGAGCTGCGCCCTCGGCTCTGCCACCTGCGAAAGGGACCTCAG
  GGCTATGGGTTCAACCTGCATAGTGACAAGTCCCGGCCCGGCCAGTACATCCGCTCTGTGGACCCGGGC
  TCACCTGCCGCCCGCTCTGGCCTCCGCGCCCAGGACCGGCTCATTGAGGTGAACGGGCAGAATGTGGAG
  GGACTGCGCCATGCTGAGGTGGTGGCCAGCATCAAGGCACGGGAGGACGAGGCCCGGCTGCTGGTCGTG
  GACCCCGAGACAGATGAACACTTCAAGCGGCTTCGGGTCACACCCACCGAGGAGCACGTGGAAGGTCCT
  CTGCCGTCACCCGTCACCAATGGAACCAGCCCTGCCCAGCTCAATGGTGGCTCTGCGTGCTCGTCCCGA
  AGTGACCTGCCTGGTTCCGACAAGGACACTGAGGATGGCAGTGCCTGGAAGCAAGATCCCTTCCAGGAG
  AGCGGCCTCCACCTGAGCCCCACGGCGGCCGAGGCCAAGGAGAAGGCTCGAGCCATGCGAGTCAACAAG
  CGCGCGCCACAGATGGACTGGAACAGGAAGCGTGAAATCTTCAGCAACTTCTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001252075
• Insert Size: 675 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001252075.1
• RefSeq Size: 1805 bp
• RefSeq ORF: 675 bp
• Locus ID: 9351
• Cytogenetics: 16p13.3
• Protein Families: Druggable Genome
• MW: 24.5 kDa
• Gene Summary: This gene encodes a member of the NHERF family of PDZ scaffolding proteins. These proteins mediate many cellular processes by binding to and regulating the membrane expression and protein-protein interactions of membrane receptors and transport proteins. The encoded protein plays a role in intestinal sodium absorption by regulating the activity of the sodium/hydrogen exchanger 3, and may also regulate the cystic fibrosis transmembrane regulator (CFTR) ion channel. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
  Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (d) is shorter and has a distinct N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.