THAP5 (NM_001287598) Human Untagged Clone

CAT#: SC334660

THAP5 (untagged) - Human THAP domain containing 5 (THAP5), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: THAP5
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334660 representing NM_001287598.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGTTAACTCTTAATCTAGTTAAACAACATACTGGGAAACCAGAATCTACCTTGGAAACATCAGTTAAC
  CAAGATACAGGTAGAGGTGGTTTTCACACATGTTTTGAGAATCTAAATTCTACAACTATTACTTTGACA
  ACTTCAAATTCAGAAAGTATTCATCAATCTTTGGAAACTCAAGAAGTTCTTGAAGTAACTACCAGTCAT
  CTTGCTAATCCAAACTTTACAAGTAATTCCATGGAAATAAAGTCAGCACAGGAAAATCCATTCTTATTC
  AGCACAATTAATCAAACAGTTGAAGAATTAAACACAAATAAAGAATCTGTTATTGCCATTTTTGTACCT
  GCTGAAAATTCTAAACCCTCAGTTAATTCTTTTATATCTGCACAAAAAGAAACCACGGAAATGGAAGAC
  ACAGACATTGAAGACTCCTTGTATAAGGATGTAGACTATGGGACAGAAGTTTTACAAATCGAACATTCT
  TACTGCAGACAAGATATAAATAAGGAACATCTTTGGCAGAAAGTCTCTAAGCTACATTCAAAGATAACT
  CTTCTAGAGTTAAAAGAGCAACAAACTCTAGGTAGATTGAAGTCTTTGGAAGCTCTTATAAGGCAGCTA
  AAGCAGGAAAACTGGCTATCTGAAGAAAACGTCAAGATTATAGAAAACCATTTTACAACATATGAAGTC
  ACTATGATATAG
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001287598
• Insert Size: 702 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001287598.1
• RefSeq Size: 3388 bp
• RefSeq ORF: 702 bp
• Locus ID: 168451
• UniProt ID: Q7Z6K1
• Cytogenetics: 7q31.1
• MW: 26.6 kDa
• Gene Summary: Has sequence-specific DNA-binding activity and can function as transcriptional repressor (in vitro) (PubMed:21110952). May be a regulator of cell cycle: THAP5 overexpression in human cell lines causes cell cycle arrest at G2/M phase (PubMed:19502560).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at a downstream start codon, compared to variant 1. Variants 3, 4 and 5 encode the same isoform (3), which is shorter at the N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.