THAP5 (NM_001287601) Human Untagged Clone

CAT#: SC334662

THAP5 (untagged) - Human THAP domain containing 5 (THAP5), transcript variant 5


  "NM_001287601" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
THAP5 mouse monoclonal antibody,clone OTI2D7
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "THAP5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol THAP5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334662 representing NM_001287601.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTTAACTCTTAATCTAGTTAAACAACATACTGGGAAACCAGAATCTACCTTGGAAACATCAGTTAAC
CAAGATACAGGTAGAGGTGGTTTTCACACATGTTTTGAGAATCTAAATTCTACAACTATTACTTTGACA
ACTTCAAATTCAGAAAGTATTCATCAATCTTTGGAAACTCAAGAAGTTCTTGAAGTAACTACCAGTCAT
CTTGCTAATCCAAACTTTACAAGTAATTCCATGGAAATAAAGTCAGCACAGGAAAATCCATTCTTATTC
AGCACAATTAATCAAACAGTTGAAGAATTAAACACAAATAAAGAATCTGTTATTGCCATTTTTGTACCT
GCTGAAAATTCTAAACCCTCAGTTAATTCTTTTATATCTGCACAAAAAGAAACCACGGAAATGGAAGAC
ACAGACATTGAAGACTCCTTGTATAAGGATGTAGACTATGGGACAGAAGTTTTACAAATCGAACATTCT
TACTGCAGACAAGATATAAATAAGGAACATCTTTGGCAGAAAGTCTCTAAGCTACATTCAAAGATAACT
CTTCTAGAGTTAAAAGAGCAACAAACTCTAGGTAGATTGAAGTCTTTGGAAGCTCTTATAAGGCAGCTA
AAGCAGGAAAACTGGCTATCTGAAGAAAACGTCAAGATTATAGAAAACCATTTTACAACATATGAAGTC
ACTATGATATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001287601
Insert Size 702 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001287601.1
RefSeq Size 3241 bp
RefSeq ORF 702 bp
Locus ID 168451
UniProt ID Q7Z6K1
Cytogenetics 7q31.1
MW 26.6 kDa
Gene Summary Has sequence-specific DNA-binding activity and can function as transcriptional repressor (in vitro) (PubMed:21110952). May be a regulator of cell cycle: THAP5 overexpression in human cell lines causes cell cycle arrest at G2/M phase (PubMed:19502560).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (5) differs in the 5' UTR, lacks an alternate exon in the 5' coding region and initiates translation at a downstream start codon, compared to variant 1. Variants 3, 4 and 5 encode the same isoform (3), which is shorter at the N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.