MICA (NM_001289153) Human Untagged Clone

CAT#: SC334691

MICA (untagged) - Human MHC class I polypeptide-related sequence A (MICA), transcript variant 2


  "NM_001289153" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00


MICA mouse monoclonal antibody, clone OTI2F5
    • 100 ul

USD 379.00

Other products for "MICA"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MICA
Synonyms MIC-A; PERB11.1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334691 representing NM_001289153.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACCCTGGCTCATATCAAGGACCAGAAAGAAGGCTTGCATTCCCTCCAGGAGATTAGGGTCTGTGAG
ATCCATGAAGACAACAGCACCAGGAGCTCCCAGCATTTCTACTACGATGGGGAGCTCTTCCTCTCCCAA
AACCTGGAGACTGAGGAATGGACAGTGCCCCAGTCCTCCAGAGCTCAGACCTTGGCCATGAACGTCAGG
AATTTCTTGAAGGAAGATGCCATGAAGACCAAGACACACTATCACGCTATGCATGCAGACTGCCTGCAG
GAACTACGGCGATATCTAGAATCCGGCGTAGTCCTGAGGAGAACAGTGCCCCCCATGGTGAATGTCACC
CGCAGCGAGGCCTCAGAGGGCAACATCACCGTGACATGCAGGGCTTCCAGCTTCTATCCCCGGAATATC
ATACTGACCTGGCGTCAGGATGGGGTATCTTTGAGCCACGACACCCAGCAGTGGGGGGATGTCCTGCCT
GATGGGAATGGAACCTACCAGACCTGGGTGGCCACCAGGATTTGCCGAGGAGAGGAGCAGAGGTTCACC
TGCTACATGGAACACAGCGGGAATCACAGCACTCACCCTGTGCCCTCTGGGAAAGTGCTGGTGCTTCAG
AGTCATTGGCAGACATTCCATGTTTCTGCTGTTGCTGCTGGCTGCTGCTATTTTTGTTATTATTATTTT
CTATGTCCGTTGTTGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001289153
Insert Size 708 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001289153.1
RefSeq Size 2258 bp
RefSeq ORF 708 bp
Locus ID 100507436
Cytogenetics 6p21.33
MW 27.1 kDa
Gene Summary This gene encodes the highly polymorphic major histocompatability complex class I chain-related protein A. The protein product is expressed on the cell surface, although unlike canonical class I molecules it does not seem to associate with beta-2-microglobulin. It is a ligand for the NKG2-D type II integral membrane protein receptor. The protein functions as a stress-induced antigen that is broadly recognized by intestinal epithelial gamma delta T cells. Variations in this gene have been associated with susceptibility to psoriasis 1 and psoriatic arthritis, and the shedding of MICA-related antibodies and ligands is involved in the progression from monoclonal gammopathy of undetermined significance to multiple myeloma. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Transcript Variant: This variant (2) contains an alternate 5' exon and it thus differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation from a downstream in-frame start codon, compared to variant 1 (MICA*00801 allele). The encoded isoform (3) is shorter at the N-terminus, compared to isoform 2. This RefSeq represents the MICA*00801 allelic form of variant 2; the MICA*00801 allele is found in the primary, ALT_REF_LOCI_2 and ALT_REF_LOCI_7 assembly units of the GRCh38 reference genome sequence. Both variants 2 and 3 encode the same isoform.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.