HAGH (NM_001286249) Human Untagged Clone

CAT#: SC334693

HAGH (untagged) - Human hydroxyacylglutathione hydrolase (HAGH), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HAGH
• Synonyms: GLO2; GLX2; GLXII; HAGH1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334693 representing NM_001286249.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGTGGTGGGCCGAGGGCTGCTCGGCCGCCGCAGCCTCGCCGCGCTGGGAGCCGCCTGCGCCCGCCGA
  GGCCTCGGTCCAGCCCTGCTGGGAGTTTTCTGCCACACAGATTTGCGGAAGAACCTGACCGTGGACGAG
  GGCACCATGAAGGTAGAGGTGCTGCCTGCCCTGACCGACAACTACATGTACCTGGTCATTGATGATGAG
  ACCAAGGAGGCTGCCATTGTGGATCCGGTGCAGCCCCAGAAGGTCGTGGACGCGGCGAGAAAGCACGGG
  GTGAAACTGACCACAGTGCTCACCACCCACCACCACTGGGACCATGCTGGCGGGAATGAGAAACTGGTC
  AAGCTGGAGTCGGGACTGAAGGTGTACGGGGGTGACGACCGTATCGGGGCCCTGACTCACAAGATCACT
  CACCTGTCCACACTGCAGGTGACACCTTGTTTGTGGCTGGCTGCGGGAAGTTCTATGAAGGGACTGCGG
  ATGAGATGTGTAAAGCTCTGCTGGAGGTCTTGGGCCGGCTCCCCCCGGACACAAGAGTCTACTGTGGCC
  ACGAGTACACCATCAACAACCTCAAGTTTGCACGCCACGTGGAGCCCGGCAATGCCGCCATCCGGGAGA
  AGCTGGCCTGGGCCAAGGAGAAGTACAGCATCGGGGAGCCCACAGTGCCATCCACCCTGGCAGAGGAGT
  TTACCTACAACCCCTTCATGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001286249
• Insert Size: 711 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001286249.1
• RefSeq Size: 1443 bp
• RefSeq ORF: 711 bp
• Locus ID: 3029
• UniProt ID: Q16775
• Cytogenetics: 16p13.3
• Protein Families: Druggable Genome
• Protein Pathways: Pyruvate metabolism
• MW: 25.5 kDa
• Gene Summary: The enzyme encoded by this gene is classified as a thiolesterase and is responsible for the hydrolysis of S-lactoyl-glutathione to reduced glutathione and D-lactate. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2013]
  Transcript Variant: This variant (3) lacks an alternate coding exon compared to variant 1, that causes a frameshift. The resulting isoform (3) has a shorter and distinct C-terminus compared to isoform 1.