CLIC1 (NM_001287593) Human Untagged Clone

CAT#: SC334750

CLIC1 (untagged) - Human chloride intracellular channel 1 (CLIC1), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CLIC1
• Synonyms: CL1C1; CLCNL1; G6; NCC27
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC334750 representing NM_001287593.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGGCTGAAGAACAACCGCAGGTCGAATTGTTCGTGAAGGCTGGCAGTGATGGGGCCAAGATTGGGAAC
  TGCCCATTCTCCCAGAGACTGTTCATGGTACTGTGGCTCAAGGGAGTCACCTTCAATGTTACCACCGTT
  GACACCAAAAGGCGGACCGAGACAGTGCAGAAGCTGTGCCCAGGGGGGCAGCTCCCATTCCTGCTGTAT
  GGCACTGAAGTGCACACAGACACCAACAAGATTGAGGAATTTCTGGAGGCAGTGCTGTGCCCTCCCAGG
  TACCCCAAGCTGGCAGCTCTGAACCCTGAGTCCAACACAGCTGGGCTGGACATATTTGCCAAATTTTCT
  GCCTACATCAAGAATTCAAACCCAGCACTCAATGACAATCTGGAGAAGGGACTCCTGAAAGCCCTGAAG
  GTTTTAGACAATTACTTAACATCCCCCCTCCCAGAAGAAGTGGATGAAACCAGTGCTGAAGATGAAGGT
  GTCTCTCAGAGGAAGTTTTTGGATGGCAACGAGCTCACCCTGGCTGACTGCAACCTGTTGCCAAAGTTA
  CACATAGTACAGGTGGTGTGTAAGAAGTACCGGGGATTCACCATCCCCGAGGCCTTCCGGGGAGTGCAT
  CGGTACTTGAGCAATGCCTACGCCCGGGAAGAATTCGCTTCCACCTGTCCAGATGATGAGGAGATCGAG
  CTCGCCTATGAGCAAGTGGCAAAGGCCCTCAAATAA
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001287593
• Insert Size: 726 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001287593.1
• RefSeq Size: 1574 bp
• RefSeq ORF: 726 bp
• Locus ID: 1192
• UniProt ID: O00299
• Cytogenetics: 6p21.33
• Protein Families: Druggable Genome, Ion Channels: Other
• MW: 26.9 kDa
• Gene Summary: Chloride channels are a diverse group of proteins that regulate fundamental cellular processes including stabilization of cell membrane potential, transepithelial transport, maintenance of intracellular pH, and regulation of cell volume. Chloride intracellular channel 1 is a member of the p64 family; the protein localizes principally to the cell nucleus and exhibits both nuclear and plasma membrane chloride ion channel activity. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2 and 3 encode the same protein.