C21orf7 (MAP3K7CL) (NM_001286634) Human Untagged Clone

CAT#: SC334759

MAP3K7CL (untagged) - Human MAP3K7 C-terminal like (MAP3K7CL), transcript variant 2


  "NM_001286634" in other vectors (1)

Reconstitution Protocol

USD 341.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Rabbit Polyclonal Anti-C21orf7 Antibody
    • 100 ul

USD 410.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "MAP3K7CL"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MAP3K7CL
Synonyms C21orf7; HC21ORF7; TAK1L; TAKL; TAKL-1; TAKL-2; TAKL-4
Vector pCMV6-Entry
Sequence Data
>SC334759 representing NM_001286634.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTTCAGCTGATTGCACCTTTAGAAGTTATGTGGAACGAGGCAGCAGATCTTAAGCCCCTTGCTCTG
TCACGCAGGCTGGAATGCAGTGGTGGAATCATGGCTCACTACAGCCCTGACCTCCTGGGCCCAGAGATG
GAGTCTCGCTATTTTGCCCAGGTTGGTCTTGAACACCTGGCTTCAAGCAGTCCTCCTGCTTTTGGCTTC
TTGAAGTGCTTGGATTACAGTATTTCAGTTTTATGCTCTGCAACAAGTTTGGCCATGTTGGAGGACAAT
CCAAAGGTCAGCAAGTTGGCTACTGGCGATTGGATGCTCACTCTGAAGCCAAAGTCTATTACTGTGCCC
GTGGAAATCCCCAGCTCCCCTCTGGATGATACACCCCCTGAAGACTCCATTCCTTTGGTCTTTCCAGAA
TTAGACCAGCAGCTACAGCCCCTGCCGCCTTGTCATGACTCCGAGGAATCCATGGAGGTGTTCAAACAG
CACTGCCAAATAGCAGAAGAATACCATGAGGTCAAAAAGGAAATCACCCTGCTTGAGCAAAGGAAGAAG
GAGCTCATTGCCAAGTTAGATCAGGCAGAAAAGGAGAAGGTGGATGCTGCTGAGCTGGTTCGGGAATTC
GAGGCTCTGACGGAGGAGAATCGGACGTTGAGGTTGGCCCAGTCTCAATGTGTGGAACAACTGGAGAAA
CTTCGAATACAGTATCAGAAGAGGCAGGGCTCGTCCTAA

Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001286634
Insert Size 729 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001286634.1
RefSeq Size 2031 bp
RefSeq ORF 729 bp
Locus ID 56911
UniProt ID P57077
Cytogenetics 21q21.3
Protein Families Transcription Factors
MW 27.2 kDa

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.