SUSD3 (NM_001287005) Human Untagged Clone

CAT#: SC334762

SUSD3 (untagged) - Human sushi domain containing 3 (SUSD3), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SUSD3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334762 representing NM_001287005.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGAAAAACATAGGCCTTGTGATGGAATGGGAAATTCCAGAGATAATTTGCACGTGCGCTAAGCTGCGG
  CTACCCCCGCAAGCAACCTTCCAAGTCCTTCGTGGCAATGGTGCTTCCGTGGGGACCGTGCTCATGTTC
  CGCTGCCCCTCCAACCACCAGATGGTGGGGTCTGGGCTCCTCACCTGCACCTGGAAGGGGAGCATCGCT
  GAGTGGTCTTCAGGGTCCCCAGTGTGCAAACTGGTGCCACCACACGAGACCTTTGGCTTCAAGGTGGCC
  GTGATCGCCTCCATTGTGAGCTGTGCCATCATCCTGCTCATGTCCATGGCCTTCCTCACCTGCTGCCTC
  CTCAAGTGCGTGAAGAAGAGCAAGCGGCGGCGCTCCAACAGGTCAGCCCAGCTGTGGTCCCAGCTGAAA
  GATGAGGACTTGGAGACGGTGCAGGCCGCATACCTTGGCCTCAAGCACTTCAACAAACCCGTGAGCGGG
  CCCAGCCAGGCGCACGACAACCACAGCTTCACCACAGACCATGGTGAGAGCACCAGCAAGCTGGCCAGT
  GTGACCCGCAGCGTGGACAAGGACCCTGGGATCCCCAGAGCTCTAAGCCTCAGTGGCTCCTCCAGCTCA
  CCCCAAGCCCAGGTGATGGTGCACATGGCAAACCCCAGACAGCCCCTGCCTGCCTCTGGGCTGGCCACA
  GGAATGCCACAACAGCCCGCAGCATATGCCCTAGGGTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001287005
• Insert Size: 729 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001287005.1
• RefSeq Size: 1337 bp
• RefSeq ORF: 729 bp
• Locus ID: 203328
• UniProt ID: Q96L08
• Cytogenetics: 9q22.31
• Protein Families: Transmembrane
• MW: 26 kDa
• Gene Summary: May play a role in breast tumorigenesis by promoting estrogen-dependent cell proliferation, cell-cell interactions and migration.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) includes an additional exon in the 5' region, and it thus differs in its 5' UTR and initiates translation from an alternate start codon, compared to variant 1. The encoded isoform (b) has a distinct N-terminus and is shorter than isoform a.