Slap (SLA) (NM_001282964) Human Untagged Clone

CAT#: SC334813

SLA (untagged) - Human Src-like-adaptor (SLA), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SLA
• Synonyms: SLA1; SLAP
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334813 representing NM_001282964.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGCTCCACCGGCTCTGGGCATCACCAGCGGCCCCAGGGAAAAAGAAAGAAATGGGAAACAGCATGAAA
  TCCACCCCTGCGCCTGCCGAGAGGCCCCTGCCCAACCCGGAGGGACTGGATAGCGACTTCCTTGCCGTG
  CTAAGTGACTACCCGTCTCCTGACATCAGCCCCCCGATATTCCGCCGAGGGGAGAAACTGCGTGTGATT
  TCTGATGAAGGGGGCTGGTGGAAAGCTATTTCTCTTAGCACTGGTCGAGAGAGTTACATCCCTGGAATA
  TGTGTGGCCAGAGTTTACCATGGCTGGCTGTTTGAGGGCCTGGGCAGAGACAAGGCCGAGGAGCTGCTG
  CAGCTGCCAGACACAAAGGTCGGCTCCTTCATGATCAGAGAGAGTGAGACCAAGAAAGAGGTGGCTGAT
  GGCCTGTGCTGTGTGCTCACCACGCCCTGCCTGACACAAAGCACGGCTGCCCCAGCAGTGAGGGCCTCC
  AGCTCACCTGTCACCTTGCGTCAGAAGACTGTGGACTGGAGGAGAGTGTCCAGACTGCAGGAGGACCCC
  GAGGGAACAGAGAACCCGCTTGGGGTAGACGAGTCCCTTTTCAGCTATGGCCTTCGAGAGAGCATTGCC
  TCTTACCTGTCCCTGACCAGTGAGGACAACACCTCCTTTGATCGAAAGAAGAAAAGCATCTCCCTGATG
  TATGGTGGCAGCAAGAGAAAGAGCTCATTCTTCTCATCACCACCTTACTTTGAGGACTAG
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001282964
• Insert Size: 750 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001282964.1
• RefSeq Size: 3065 bp
• RefSeq ORF: 750 bp
• Locus ID: 6503
• UniProt ID: Q13239
• Cytogenetics: 8q24.22
• Protein Families: Druggable Genome
• MW: 27.6 kDa
• Gene Summary: Adapter protein, which negatively regulates T-cell receptor (TCR) signaling. Inhibits T-cell antigen-receptor induced activation of nuclear factor of activated T-cells. Involved in the negative regulation of positive selection and mitosis of T-cells. May act by linking signaling proteins such as ZAP70 with CBL, leading to a CBL dependent degradation of signaling proteins.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (4) differs in the 5' UTR and lacks an in-frame exon in the centtral coding region compared to variant 1. These differences result in the use of an upstream start codon compared to varian 1. The encoded isoform (d) is shorter but has an extended N-terminus compare to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.