RFC2 (NM_001278792) Human Untagged Clone

CAT#: SC334830

RFC2 (untagged) - Human replication factor C (activator 1) 2, 40kDa (RFC2), transcript variant 4


  "NM_001278792" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
RFC2 mouse monoclonal antibody, clone OTI3A7 (formerly 3A7)
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "RFC2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RFC2
Synonyms RFC40
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334830 representing NM_001278792.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTGCCCAACATCATCATTGCGGGGCATTGACGTTGTGAGGAATAAAATTAAAATGTTTGCTCAACAA
AAAGTCACTCTTCCCAAAGGCCGACATAAGATCATCATTCTGGATGAAGCAGACAGCATGACCGACGGA
GCCCAGCAAGCCTTGAGGAGAACCATGGAAATCTACTCTAAAACCACTCGCTTCGCCCTTGCTTGTAAT
GCTTCGGATAAGATCATCGAGCCCATTCAGTCCCGCTGTGCAGTCCTCCGGTACACAAAGCTGACCGAC
GCCCAGATCCTCACCAGGCTGATGAATGTTATCGAGAAGGAGAGGGTACCCTACACTGATGACGGCCTA
GAAGCCATCATCTTCACGGCCCAGGGAGACATGAGGCAGGCGCTGAACAACCTGCAGTCCACCTTCTCA
GGATTTGGCTTCATTAACAGTGAGAACGTGTTCAAGGTCTGTGACGAGCCCCACCCACTGCTGGTAAAG
GAGATGATCCAGCACTGTGTGAATGCCAACATTGACGAAGCCTACAAGATTCTTGCTCACTTGTGGCAT
CTGGGCTACTCACCAGAAGATATCATTGGCAACATCTTTCGAGTGTGTAAAACTTTCCAAATGGCAGAA
TACCTGAAACTGGAGTTTATCAAGGAAATTGGATACACTCACATGAAAATAGCGGAAGGAGTGAACTCT
CTTTTGCAGATGGCAGGCCTCCTGGCAAGGCTGTGTCAGAAGACAATGGCCCCGGTGGCCAGTTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001278792
Insert Size 756 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278792.1
RefSeq Size 1652 bp
RefSeq ORF 756 bp
Locus ID 5982
UniProt ID P35250
Cytogenetics 7q11.23
Protein Families Druggable Genome, Stem cell - Pluripotency
Protein Pathways DNA replication, Mismatch repair, Nucleotide excision repair
MW 28.4 kDa
Gene Summary This gene encodes a member of the activator 1 small subunits family. The elongation of primed DNA templates by DNA polymerase delta and epsilon requires the action of the accessory proteins, proliferating cell nuclear antigen (PCNA) and replication factor C (RFC). Replication factor C, also called activator 1, is a protein complex consisting of five distinct subunits. This gene encodes the 40 kD subunit, which has been shown to be responsible for binding ATP and may help promote cell survival. Disruption of this gene is associated with Williams syndrome. Alternatively spliced transcript variants encoding distinct isoforms have been described. A pseudogene of this gene has been defined on chromosome 2. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (4) lacks an exon in the central coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (4) has a shorter and distinct N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.