SLC35B1 (NM_001278784) Human Untagged Clone

CAT#: SC334871

SLC35B1 (untagged) - Human solute carrier family 35, member B1 (SLC35B1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SLC35B1
• Synonyms: AXER; UGTREL1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334871 representing NM_001278784.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGTGTGATCAATGCTGTGTTTGCCAAGATCTGGTGGATCGTACCCGGAGCTGGCTCTATGCTGCCTGT
  TCTATCTCCTATCTGGGTGCCATGGTCTCCAGCAATTCAGCACTACAGTTTGTCAACTACCCAACTCAG
  GTCCTTGGTAAATCCTGCAAGCCAATCCCAGTCATGCTCCTTGGGGTGACCCTCTTGAAGAAGAAGTAC
  CCGTTGGCCAAGTACCTGTGTGTGCTGTTAATTGTGGCTGGAGTGGCCCTTTTCATGTACAAACCCAAG
  AAAGTTGTTGGGATAGAAGAACACACAGTCGGCTATGGAGAGCTACTCTTGCTATTATCGCTGACCCTG
  GATGGACTGACTGGTGTTTCCCAGGACCACATGCGGGCTCATTACCAAACAGGCTCCAACCACATGATG
  CTGAACATCAACCTTTGGTCGACATTGCTGCTGGGAATGGGAATCCTGTTCACTGGGGAGCTCTGGGAG
  TTCTTGAGCTTTGCTGAAAGGTACCCTGCCATCATCTATAACATCCTGCTCTTTGGGCTGACCAGTGCC
  CTGGGTCAGAGCTTCATCTTTATGACGGTTGTGTATTTTGGTCCCCTGACCTGCTCCATCATCACTACA
  ACTCGAAAGTTCTTCACAATTTTGGCCTCTGTGATCCTCTTCGCCAATCCCATCAGCCCCATGCAGTGG
  GTGGGCACTGTGCTTGTGTTCCTGGGTCTTGGTCTTGATGCCAAGTTTGGGAAAGGAGCTAAGAAGACA
  TCCCACTAG
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001278784
• Insert Size: 768 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001278784.1
• RefSeq Size: 1596 bp
• RefSeq ORF: 768 bp
• Locus ID: 10237
• Cytogenetics: 17q21.33
• Protein Families: Transmembrane
• MW: 28.2 kDa
• Gene Summary: This gene encodes a nucleotide sugar transporter which is a member of solute carrier family 35. The transporters in this family are highly conserved hydrophobic proteins with multiple transmembrane domains. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
  Transcript Variant: This variant (2) uses an alternate splice site in the 5' coding region and initiates translation at downstream start codon compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1.