ASZ1 (NM_001301822) Human Untagged Clone

CAT#: SC334937

ASZ1 (untagged) - Human ankyrin repeat, SAM and basic leucine zipper domain containing 1 (ASZ1), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ASZ1
• Synonyms: ALP1; ANKL1; C7orf7; CT1.19; GASZ; Orf3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334937 representing NM_001301822.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGCTACAAACCAAAGATGGAAAGATGCCAAGTGAGATTGCAAAAAGAAACAAACATCATGAGATCTTC
  AACTTACTTTCTTTTACTTTAAATCCATTGGAAGGAAAACTTCAACAGCTAACTAAAGAAGACACTATT
  TGTAAAATATTGACAACAGATTCTGATAGAGAAAAAGATCACATTTTTAGTTCATATACAGCATTTGGA
  GATCTGGAAGTATTTTTACATGGTCTTGGACTTGAACATATGACAGATTTACTAAAGGAAAGGGATATA
  ACGTTAAGACATCTTTTGACCATGAGGGAAGATGAATTTACAAAGAATGGAATTACCAGTAAAGACCAG
  CAGAAAATTCTGGCTGCTCTTAAAGAACTACAGGTAGAAGAGATACAATTTGGAGAGCTATCTGAAGAG
  ACAAAGTTGGAAATCAGTGGTGATGAGTTCCTCAACTTTCTTCTCAAATTAAATAAACAGTGTGGCCAT
  TTAATAACAGCTGTACAGAATGTTATTACTGAGTTACCTGTAAATTCTCAAAAGATAACACTGGAATGG
  GCTTCTCCCCAGAATTTTACTTCAGTTTGTGAAGAATTGGTTAATAATGTTGAAGATTTGAGTGAAAAG
  GTCTGCAAACTAAAAGACCTAATTCAAAAGTTGCAAAATGAACGGGAAAATGATCCAACTCATATACAA
  TTAAGGGAAGAAGTATCTACATGGAATAGTAGAATTTTGAAGAGGACAGCTATTACCATATGCGGATTC
  GGTTTTCTTCTTTTCATTTGCAAGCTAACTTTCCAGAGGAAATAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001301822
• Insert Size: 804 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001301822.1
• RefSeq Size: 1753 bp
• RefSeq ORF: 804 bp
• Locus ID: 136991
• UniProt ID: Q8WWH4
• Cytogenetics: 7q31.2
• MW: 30.8 kDa
• Gene Summary: Plays a central role during spermatogenesis by repressing transposable elements and preventing their mobilization, which is essential for the germline integrity. Acts via the piRNA metabolic process, which mediates the repression of transposable elements during meiosis by forming complexes composed of piRNAs and Piwi proteins and governs the methylation and subsequent repression of transposons. Its association with pi-bodies suggests a participation in the primary piRNAs metabolic process. Required prior to the pachytene stage to facilitate the production of multiple types of piRNAs, including those associated with repeats involved in the regulation of retrotransposons. May act by mediating protein-protein interactions during germ cell maturation (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream start codon compared to variant 1. It encodes isoform 3 which has a shorter N-terminus compared to isoform 1.