PDLIM5 (NM_001256425) Human Untagged Clone

CAT#: SC334956

PDLIM5 (untagged) - Human PDZ and LIM domain 5 (PDLIM5), transcript variant 3


  "NM_001256425" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
PDLIM5 mouse monoclonal antibody, clone OTI1A11 (formerly 1A11)
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "PDLIM5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PDLIM5
Synonyms ENH; ENH1; L9; LIM
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334956 representing NM_001256425.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCCGAGAGCCTGGACAGCCCAACCTCTGGCAGACCAGGGGTTACCAGCCTCACAACTGCAGCTGCC
TTCAAGCCTGTAGGATCCACTGGCGTCATCAAGTCACCAAGCTGGCAACGGCCAAACCAAGGAGTACCT
TCCACTGGAAGAATCTCAAACAGCGCTACTTACTCAGGATCAGTGGCACCAGCCAACTCAGCTTTGGGA
CAAACCCAGCCAAGTGACCAGGACACTTTAGTGCAAAGAGCTGAGCACATTCCAGCAGGGAAACGAACT
CCGATGTGCGCCCATTGTAACCAGGTCATCAGAGGACCATTCTTAGTGGCACTGGGGAAATCTTGGCAC
CCAGAAGAATTCAACTGCGCTCACTGCAAAAATACAATGGCCTACATTGGATTTGTAGAGGAGAAAGGA
GCCCTGTATTGTGAGCTGTGCTATGAGAAATTCTTTGCCCCTGAATGTGGTCGATGCCAAAGGAAGATC
CTTGGAGAAGTCATCAGTGCGTTGAAACAAACTTGGCATGTTTCCTGTTTTGTGTGTGTAGCCTGTGGA
AAGCCCATTCGGAACAATGTTTTTCACTTGGAGGATGGTGAACCCTACTGTGAGACTGATTATTATGCC
CTCTTTGGTACTATATGCCATGGATGTGAATTTCCCATAGAAGCTGGTGACATGTTCCTGGAAGCTCTG
GGCTACACCTGGCATGACACTTGCTTTGTATGCTCAGTGTGTTGTGAAAGTTTGGAAGGTCAGACCTTT
TTCTCCAAGAAGGACAAGCCCCTGTGTAAGAAACATGCTCATTCTGTGAATTTTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001256425
Insert Size 816 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256425.1
RefSeq Size 5713 bp
RefSeq ORF 816 bp
Locus ID 10611
Cytogenetics 4q22.3
Protein Families Druggable Genome
MW 29.7 kDa
Gene Summary This gene encodes a member of a family of proteins that possess a 100-amino acid PDZ domain at the N terminus and one to three LIM domains at the C-terminus. This family member functions as a scaffold protein that tethers protein kinases to the Z-disk in striated muscles. It is thought to function in cardiomyocyte expansion and in restraining postsynaptic growth of excitatory synapses. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Transcript Variant: This variant (3) lacks an alternate exon in the 5' coding region and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (c) is shorter at the N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.