CLK2 (NM_001294339) Human Untagged Clone

CAT#: SC334961

CLK2 (untagged) - Human CDC-like kinase 2 (CLK2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CLK2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334961 representing NM_001294339.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGTTTGACTGGTTTGACTACCATGGCCACATGTGTATCTCCTTTGAGCTTCTGGGCCTTAGCACCTTC
  GATTTCCTCAAAGACAACAACTACCTGCCCTACCCCATCCACCAAGTGCGCCACATGGCCTTCCAGCTG
  TGCCAGGCTGTCAAGTTCCTCCATGATAACAAGCTGACACATACAGACCTCAAGCCTGAAAATATTCTG
  TTTGTGAATTCAGACTATGAGCTCACCTACAACCTAGAGAAGAAGCGAGATGAGCGCAGTGTGAAGAGC
  ACAGCTGTGCGGGTGGTAGACTTTGGCAGTGCCACCTTTGACCATGAGCACCATAGCACCATTGTCTCC
  ACTCGCCATTACCGAGCACCAGAAGTCATCCTTGAGTTGGGCTGGTCACAGCCTTGTGATGTGTGGAGT
  ATAGGCTGCATCATCTTTGAATACTATGTGGGATTCACCCTCTTCCAGACCCATGACAACAGAGAGCAT
  CTAGCCATGATGGAAAGGATCTTGGGTCCTATCCCTTCCCGGATGATCCGAAAGACAAGAAAGCAGAAA
  TATTTTTACCGGGGTCGCCTGGATTGGGATGAGAACACATCAGCTGGGCGCTATGTTCGTGAGAACTGC
  AAACCGCTGCGGCGGTATCTGACCTCAGAGGCAGAGGAACACCACCAGCTCTTCGATCTGATTGAAAGC
  ATGCTAGAGTATGAACCAGCTAAGCGGCTGACCTTGGGTGAAGCCCTTCAGCATCCTTTCTTCGCCCGC
  CTTCGGGCTGAGCCGCCCAACAAGTTGTGGGACTCCAGTCGGGATATCAGTCGGTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001294339
• Insert Size: 816 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001294339.1
• RefSeq Size: 2115 bp
• RefSeq ORF: 816 bp
• Locus ID: 1196
• UniProt ID: P49760
• Cytogenetics: 1q22
• Protein Families: Druggable Genome, Protein Kinase
• MW: 32.3 kDa
• Gene Summary: This gene encodes a dual specificity protein kinase that phosphorylates serine/threonine and tyrosine-containing substrates. Activity of this protein regulates serine- and arginine-rich (SR) proteins of the spliceosomal complex, thereby influencing alternative transcript splicing. Chromosomal translocations have been characterized between this locus and the PAFAH1B3 (platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa)) gene on chromosome 19, resulting in the production of a fusion protein. Note that this gene is distinct from the TELO2 gene (GeneID:9894), which shares the CLK2 alias, but encodes a protein that is involved in telomere length regulation. There is a pseudogene for this gene on chromosome 7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
  Transcript Variant: This variant (3) lacks an exon in the 5' region and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus than isoform 1.