PITPNB (NM_001284278) Human Untagged Clone

CAT#: SC334972

PITPNB (untagged) - Human phosphatidylinositol transfer protein, beta (PITPNB), transcript variant sp3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PITPNB
• Synonyms: PI-TP-beta; PtdInsTP; VIB1B
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334972 representing NM_001284278.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGGAGATTTGTTGATGGAGAAGTGCCGTGTGGTTTTGCCATGTTCTGTTCAGGAGTATCAGGTTGGG
  CAGCTTTACTCTGTTGCAGAAGCTAGTAAGAATGAGACTGGTGGTGGAGAAGGAATTGAAGTCTTAAAG
  AATGAACCTTATGAGAAGGATGGAGAAAAGGGACAGTATACGCACAAAATTTATCACCTAAAGAGCAAA
  GTGCCTGCATTCGTGAGGATGATTGCTCCCGAGGGCTCCTTGGTGTTTCATGAGAAAGCCTGGAATGCG
  TACCCCTACTGTAGAACAATTGTAACGAATGAATATATGAAAGATGATTTCTTCATTAAAATCGAAACA
  TGGCACAAACCAGACTTGGGAACATTAGAAAATGTACATGGTTTAGATCCAAACACATGGAAAACTGTT
  GAAATTGTCCATATAGATATTGCAGATAGAAGTCAAGTTGAACCAGCAGACTACAAAGCTGATGAAGAC
  CCAGCATTATTCCAGTCAGTCAAGACCAAGAGAGGCCCTTTGGGACCCAACTGGAAGAAGGAGCTGGCA
  AACAGCCCTGACTGTCCCCAGATGTGTGCCTATAAGCTGGTGACCATCAAATTCAAGTGGTGGGGACTG
  CAAAGCAAAGTAGAAAACTTCATTCAAAAGCAAGAAAAACGGATATTTACAAACTTCCATCGCCAGCTT
  TTTTGTTGGATTGACAAGTGGATCGATCTCACGATGGAAGACATTAGGAGAATGGAAGACGAGACTCAG
  AAAGAACTAGAAACAATGCGTAAGAGGGGTTCCGTTCGAGGCACGTCGGCTGCTGATGTCTAG
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001284278
• Insert Size: 822 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001284278.1
• RefSeq Size: 2959 bp
• RefSeq ORF: 822 bp
• Locus ID: 23760
• UniProt ID: P48739
• Cytogenetics: 22q12.1
• MW: 31.7 kDa
• Gene Summary: This gene encodes a cytoplasmic protein that catalyzes the transfer of phosphatidylinositol and phosphatidylcholine between membranes. This transfer activity is required for COPI complex-mediated retrograde transport from the Golgi apparatus to the endoplasmic reticulum. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2013]
  Transcript Variant: This variant (sp3) uses an alternate 5' terminal exon, and it thus differs in the 5' UTR and 5' coding region, compared to variant sp1. The encoded isoform (3) has a distinct N-terminus and is 2 aa longer than isoform 1.