ATG5 (NM_001286106) Human Untagged Clone

CAT#: SC334984

ATG5 (untagged) - Human autophagy related 5 (ATG5), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ATG5
• Synonyms: APG5; APG5-LIKE; APG5L; ASP; hAPG5; SCAR25
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC334984 representing NM_001286106.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGACAGATGACAAAGATGTGCTTCGAGATGTGTGGTTTGGACGAATTCCAACTTGTTTCACGCTATAT
  CAGGATGAGATAACTGAAAGGGAAGCAGAACCATACTATTTGCTTTTGCCAAGAGTAAGTTATTTGACG
  TTGGTAACTGACAAAGTGAAAAAGCACTTTCAGAAGGTTATGAGACAAGAAGACATTAGTGAGATATGG
  TTTGAATATGAAGGCACACCACTGAAATGGCATTATCCAATTGGTTTGCTATTTGATCTTCTTGCATCA
  AGTTCAGCTCTTCCTTGGAACATCACAGTACATTTTAAGAGTTTTCCAGAAAAAGACCTTCTGCACTGT
  CCATCTAAGGATGCAATTGAAGCTCATTTTATGTCATGTATGAAAGAAGCTGATGCTTTAAAACATAAA
  AGTCAAGTAATCAATGAAATGCAGAAAAAAGATCACAAGCAACTCTGGATGGGATTGCAAAATGACAGA
  TTTGACCAGTTTTGGGCCATCAATCGGAAACTCATGGAATATCCTGCAGAAGAAAATGGATTTCGTTAT
  ATCCCCTTTAGAATATATCAGACAACGACTGAAAGACCTTTCATTCAGAAGCTGTTTCGTCCTGTGGCT
  GCAGATGGACAGTTGCACACACTAGGAGATCTCCTCAAAGAAGTTTGTCCTTCTGCTATTGATCCTGAA
  GATGGGGAAAAAAAGAATCAAGTGATGATTCATGGAATTGAGCCAATGTTGGAAACACCTCTGCAGTGG
  CTGAGTGAACATCTGAGCTACCCGGATAATTTTCTTCATATTAGTATCATCCCACAGCCAACAGATTGA
  
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001286106
• Insert Size: 828 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001286106.1
• RefSeq Size: 3125 bp
• RefSeq ORF: 828 bp
• Locus ID: 9474
• UniProt ID: Q9H1Y0
• Cytogenetics: 6q21
• Protein Families: Druggable Genome
• Protein Pathways: Regulation of autophagy, RIG-I-like receptor signaling pathway
• MW: 32.4 kDa
• Gene Summary: The protein encoded by this gene, in combination with autophagy protein 12, functions as an E1-like activating enzyme in a ubiquitin-like conjugating system. The encoded protein is involved in several cellular processes, including autophagic vesicle formation, mitochondrial quality control after oxidative damage, negative regulation of the innate antiviral immune response, lymphocyte development and proliferation, MHC II antigen presentation, adipocyte differentiation, and apoptosis. Several transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode isoform a.