Centaurin alpha 1 (ADAP1) (NM_001284311) Human Untagged Clone

CAT#: SC335024

ADAP1 (untagged) - Human ArfGAP with dual PH domains 1 (ADAP1), transcript variant 5


  "NM_001284311" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Anti-ADAP1 rabbit polyclonal antibody
    • 100 ul

USD 345.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "ADAP1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ADAP1
Synonyms CENTA1; GCS1L; p42IP4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335024 representing NM_001284311.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTATTGGCTTCACTCGAGCTCCTTCGAGAGCAGTGGATCCGGGCCAAGTACGAGCGACAGGAGTTC
ATCTACCCGGAGAAGCAGGAGCCCTACTCGGCAGGGTACCGTGAGGGTTTTCTCTGGAAGCGTGGCCGG
GACAACGGGCAGTTTTTGAGCCGGAAGTTTGTGCTGACAGAACGAGAGGGTGCTCTGAAGTATTTCAAC
AGAAATGATGCCAAGGAGCCCAAGGCCGTGATGAAGATCGAGCACCTGAACGCCACCTTCCAGCCGGCC
AAGATCGGCCACCCCCACGGCCTGCAGGTCACCTACCTGAAGGACAACAGCACCCGTAACATCTTCATC
TACCATGAGGACGGGAAGGAGATTGTGGACTGGTTCAATGCACTCCGAGCTGCTCGCTTCCACTACCTG
CAGGTGGCATTCCCAGGGGCCAGCGACGCAGATCTGGTGCCAAAGCTCTCCAGGAACTACCTGAAGGAA
GGCTACATGGAGAAGACGGGGCCCAAGCAAACGGAAGGCTTCCGGAAGCGCTGGTTCACCATGGATGAC
CGCAGGCTCATGTACTTCAAAGACCCCCTGGACGCCTTCGCCCGAGGGGAAGTCTTCATTGGCAGCAAG
GAGAGTGGCTACACGGTGCTGCATGGGTTCCCGCCGTCCACCCAGGGCCACCACTGGCCACATGGCATC
ACCATCGTCACGCCCGACCGCAAGTTTCTGTTTGCCTGCGAGACGGAGTCCGACCAGAGGGAGTGGGTG
GCGGCCTTCCAGAAGGCGGTGGACAGGCCCATGCTGCCCCAGGAGTACGCAGTGGAGGCGCACTTCAAG
CATAAACCTTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001284311
Insert Size 840 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001284311.1
RefSeq Size 1963 bp
RefSeq ORF 840 bp
Locus ID 11033
UniProt ID O75689
Cytogenetics 7p22.3
Protein Families Druggable Genome
MW 32.8 kDa
Gene Summary GTPase-activating protein for the ADP ribosylation factor family (Probable). Binds phosphatidylinositol 3,4,5-trisphosphate (PtdInsP3) and inositol 1,3,4,5-tetrakisphosphate (InsP4).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (5) lacks 2 exons at the 5' end and contains an alternate 5' terminal exon, which results in translation initiation from an alternate start codon compared to variant 1. The resulting shorter isoform (4) has a distinct N-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.