Eph receptor A7 (EPHA7) (NM_001288630) Human Untagged Clone

CAT#: SC335029

EPHA7 (untagged) - Human EPH receptor A7 (EPHA7), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: EPHA7
• Synonyms: EHK-3; EHK3; EK11; HEK11
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC335029 representing NM_001288630.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGTTTTTCAAACTCGGTACCCTTCATGGATTATTTTATGCTACATCTGGCTGCTCCGCTTTGCACAC
  ACAGGGGAGGCGCAGGCTGCGAAGGAAGTACTACTGCTGGATTCTAAAGCACAACAAACAGAGTTGGAG
  TGGATTTCCTCTCCACCCAATGGGTGGGAAGAAATTAGTGGTTTGGATGAGAACTATACCCCGATACGA
  ACATACCAGGTGTGCCAAGTCATGGAGCCCAACCAAAACAACTGGCTGCGGACTAACTGGATTTCCAAA
  GGCAATGCACAAAGGATTTTTGTAGAATTGAAATTCACCCTGAGGGATTGTAACAGTCTTCCTGGAGTA
  CTGGGAACTTGCAAGGAAACATTTAATTTGTACTATTATGAAACAGACTATGACACTGGCAGGAATATA
  AGAGAAAACCTCTATGTAAAAATAGACACCATTGCTGCAGATGAAAGTTTTACCCAAGGTGACCTTGGT
  GAAAGAAAGATGAAGCTTAACACTGAGGTGAGAGAGATTGGACCTTTGTCCAAAAAGGGATTCTATCTT
  GCCTTTCAGGATGTAGGGGCTTGCATAGCTTTGGTTTCTGTCAAAGTGTACTACAAGAAGTGCTGGTCC
  ATTATTGAGAACTTAGCTATCTTTCCAGATACAGTGACTGGTTCAGAATTTTCCTCTTTAGTCGAGGTT
  CGAGGGACATGTGTCAGCAGTGCAGAGGAAGAAGCGGAAAACGCCCCCAGGATGCACTGCAGTGCAGAA
  GGAGAATGGTTAGTGCCCATTGGAAAATGTATCTGCAAAGCAGGCTACCAGCAAAAAGGAGACACTTGT
  GAACGTAAGTAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001288630
• Insert Size: 840 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001288630.1
• RefSeq Size: 1935 bp
• RefSeq ORF: 840 bp
• Locus ID: 2045
• UniProt ID: Q15375
• Cytogenetics: 6q16.1
• Protein Families: Druggable Genome, Protein Kinase, Transmembrane
• Protein Pathways: Axon guidance
• MW: 31.8 kDa
• Gene Summary: This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Increased expression of this gene is associated with multiple forms of carcinoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
  Transcript Variant: This variant (3) lacks several exons and includes an alternate 3' terminal exon, compared to variant 1. It encodes isoform 3 which is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.