Thrombopoietin (THPO) (NM_001290027) Human Untagged Clone

CAT#: SC335100

THPO (untagged) - Human thrombopoietin (THPO), transcript variant 8


  "NM_001290027" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Biotinylated Anti-Human TPO Goat Polyclonal Antibody
    • 50 ug

USD 285.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "THPO"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol THPO
Synonyms MGDF; MKCSF; ML; MPLLG; THCYT1; TPO
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335100 representing NM_001290027.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGCTGACTGAATTGCTCCTCGTGGTCATGCTTCTCCTAACTGCAAGGCTAACGCTGTCCAGCCCG
GCTCCTCCTGCTTGTGACCTCCGAGTCCTCAGTAAACTGCTTCGTGACTCCCATGTCCTTCACAGCAGA
CTGAGCCAGTGCCCAGAGGTTCACCCTTTGCCTACACCTGTCCTGCTGCCTGCTGTGGACTTTAGCTTG
GGAGAATGGAAAACCCAGATGGAGGAGACCAAGGCACAGGACATTCTGGGAGCAGTGACCCTTCTGCTG
GAGGGAGTGATGGCAGCACGGGGACAACTGGGACCCACTTGCCTCTCATCCCTCCTGGGGCAGCTTTCT
GGACAGGTCCGTCTCCTCCTTGGGGCCCTGCAGAGCCTCCTTGGAACCCAGCTTCCTCCACAGGGCAGG
ACCACAGCTCACAAGGATCCCAATGCCATCTTCCTGAGCTTCCAACACCTGCTCCGAGGAAAGGACTTC
TGGATTGTTGGAGACAAACTTCACTGCCTCAGCCAGAACTACTGGCTCTGGGCTTCTGAAGTGGCAGCA
GGGATTCAGAGCCAAGATTCCTGGTCTGCTGAACCAAACCTCCAGGTCCCTGGACCAAATCCCCGGATA
CCTGAACAGGATACACGAACTCTTGAATGGAACTCGTGGACTCTTTCCTGGACCCTCACGCAGGACCCT
AGGAGCCCCGGACATTTCCTCAGGAACATCAGACACAGGCTCCCTGCCACCCAACCTCCAGCCTGGATA
TTCTCCTTCCCCAACCCATCCTCCTACTGGACAGTATACGCTCTTCCCTCTTCCACCCACCTTGCCCAC
CCCTGTGGTCCAGCTCCACCCCCTGCTTCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001290027
Insert Size 861 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001290027.1
RefSeq Size 2074 bp
RefSeq ORF 861 bp
Locus ID 7066
UniProt ID P40225
Cytogenetics 3q27.1
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Hematopoietic cell lineage
MW 31.5 kDa
Gene Summary Megakaryocytopoiesis is the cellular development process that leads to platelet production. The main functional protein encoded by this gene is a humoral growth factor that is necessary for megakaryocyte proliferation and maturation, as well as for thrombopoiesis. This protein is the ligand for MLP/C_MPL, the product of myeloproliferative leukemia virus oncogene. Mutations in this gene are the cause of thrombocythemia 1. Alternative promoter usage and differential splicing result in multiple transcript variants differing in the 5' UTR and/or coding region. Multiple AUG codons upstream of the main open reading frame (ORF) have been identified, and these upstream AUGs inhibit translation of the main ORF at different extent. [provided by RefSeq, Feb 2014]
Transcript Variant: This variant (8) represents use of the upstream promoter and comprises seven exons. It includes two main in-frame AUG sites, but translation initiated from the upstream AUG codon for this variant is not reported in literature. The isoform (4) represented in this RefSeq is derived from the downstream AUG start codon; it is identical to the isoform encoded by variant 4 and lacks an internal segment, as compared to isoform 1. This variant was reported in PMID: 7822271. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.