SLC22A17 (NM_001289050) Human Untagged Clone

CAT#: SC335211

SLC22A17 (untagged) - Human solute carrier family 22, member 17 (SLC22A17), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SLC22A17
• Synonyms: 24p3R; BOCT; BOIT; hBOIT; NGALR; NGALR2; NGALR3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001289050, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGATCACCGCTCCCTGCATCCTCTTCCTGTTTTATGGCTGGCCTGGTTTGTTCCTGGAGTCCGCACGGT
  GGCTGATAGTGAAGCGGCAGATTGAGGAGGCTCAGTCTGTGCTGAGGATCCTGGCTGAGCGAAACCGGCC
  CCATGGGCAGATGCTGGGGGAGGAGGCCCAGGAGGCCCTGCAGGACCTGGAGAATACCTGCCCTCTCCCT
  GCAACATCCTCCTTTTCCTTTGCTTCCCTCCTCAACTACCGCAACATCTGGAAAAATCTGCTTATCCTGG
  GCTTCACCAACTTCATTGCCCATGCCATTCGCCACTGCTACCAGCCTGTGGGAGGAGGAGGGAGCCCATC
  GGACTTCTACCTGTGCTCTCTGCTGGCCAGCGGCACCGCAGCCCTGGCCTGTGTCTTCCTGGGGGTCACC
  GTGGACCGATTTGGCCGCCGGGGCATCCTTCTTCTCTCCATGACCCTTACCGGCATTGCTTCCCTGGTCC
  TGCTGGGCCTGTGGGATTATCTGAACGAGGCTGCCATCACCACTTTCTCTGTCCTTGGGCTCTTCTCCTC
  CCAAGCTGCCGCCATCCTCAGCACCCTCCTTGCTGCTGAGGTCATCCCCACCACTGTCCGGGGCCGTGGC
  CTGGGCCTGATCATGGCTCTAGGGGCGCTTGGAGGACTGAGCGGCCCGGCCCAGCGCCTCCACATGGGCC
  ATGGAGCCTTCCTGCAGCACGTGGTGCTGGCGGCCTGCGCCCTCCTCTGCATTCTCAGCATTATGCTGCT
  GCCGGAGACCAAGCGCAAGCTCCTGCCCGAGGTGCTCCGGGACGGGGAGCTGTGTCGCCGGCCTTCCCTG
  CTGCGGCAGCCACCCCCTACCCGCTGTGACCACGTCCCGCTGCTTGCCACCCCCAACCCTGCCCTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001289050
• ORF Size: 909 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001289050.1, NP_001275979.1
• RefSeq Size: 2027
• RefSeq ORF: 909
• Locus ID: 51310
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: Cell surface receptor for LCN2 (24p3) that plays a key role in iron homeostasis and transport. Able to bind iron-bound LCN2 (holo-24p3), followed by internalization of holo-24p3 and release of iron, thereby increasing intracellular iron concentration and leading to inhibition of apoptosis. Also binds iron-free LCN2 (apo-24p3), followed by internalization of apo-24p3 and its association with an intracellular siderophore, leading to iron chelation and iron transfer to the extracellular medium, thereby reducing intracellular iron concentration and resulting in apoptosis. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) uses an alternate splice junction at the 5' end of a coding exon and an alternate in-frame splice junction at the 3' end of another exon compared to variant 1. The resulting isoform (c) is shorter at the N-terminus and lacks an alternate internal segment compared to isoform a.