CLIC1 (NM_001287594) Human Untagged Clone

CAT#: SC334751

CLIC1 (untagged) - Human chloride intracellular channel 1 (CLIC1), transcript variant 3


  "NM_001287594" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Rabbit Polyclonal Anti-CLIC1 Antibody
    • 100 ul

USD 310.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "CLIC1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CLIC1
Synonyms CL1C1; CLCNL1; G6; NCC27
Vector pCMV6-Entry
Sequence Data
>SC334751 representing NM_001287594.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCTGAAGAACAACCGCAGGTCGAATTGTTCGTGAAGGCTGGCAGTGATGGGGCCAAGATTGGGAAC
TGCCCATTCTCCCAGAGACTGTTCATGGTACTGTGGCTCAAGGGAGTCACCTTCAATGTTACCACCGTT
GACACCAAAAGGCGGACCGAGACAGTGCAGAAGCTGTGCCCAGGGGGGCAGCTCCCATTCCTGCTGTAT
GGCACTGAAGTGCACACAGACACCAACAAGATTGAGGAATTTCTGGAGGCAGTGCTGTGCCCTCCCAGG
TACCCCAAGCTGGCAGCTCTGAACCCTGAGTCCAACACAGCTGGGCTGGACATATTTGCCAAATTTTCT
GCCTACATCAAGAATTCAAACCCAGCACTCAATGACAATCTGGAGAAGGGACTCCTGAAAGCCCTGAAG
GTTTTAGACAATTACTTAACATCCCCCCTCCCAGAAGAAGTGGATGAAACCAGTGCTGAAGATGAAGGT
GTCTCTCAGAGGAAGTTTTTGGATGGCAACGAGCTCACCCTGGCTGACTGCAACCTGTTGCCAAAGTTA
CACATAGTACAGGTGGTGTGTAAGAAGTACCGGGGATTCACCATCCCCGAGGCCTTCCGGGGAGTGCAT
CGGTACTTGAGCAATGCCTACGCCCGGGAAGAATTCGCTTCCACCTGTCCAGATGATGAGGAGATCGAG
CTCGCCTATGAGCAAGTGGCAAAGGCCCTCAAATAA

Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001287594
Insert Size 726 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001287594.1
RefSeq Size 1111 bp
RefSeq ORF 726 bp
Locus ID 1192
UniProt ID O00299
Cytogenetics 6p21.33
Protein Families Druggable Genome, Ion Channels: Other
MW 26.9 kDa
Gene Summary Chloride channels are a diverse group of proteins that regulate fundamental cellular processes including stabilization of cell membrane potential, transepithelial transport, maintenance of intracellular pH, and regulation of cell volume. Chloride intracellular channel 1 is a member of the p64 family; the protein localizes principally to the cell nucleus and exhibits both nuclear and plasma membrane chloride ion channel activity. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) has an alternate exon in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.