PRAS40 (AKT1S1) (NM_001278160) Human Untagged Clone

CAT#: SC334875

AKT1S1 (untagged) - Human AKT1 substrate 1 (proline-rich) (AKT1S1), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: AKT1S1
• Synonyms: Lobe; PRAS40
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC334875 representing NM_001278160.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGGCGTCGGGGCGCCCCGAGGAGCTGTGGGAGGCCGTGGTGGGGGCCGCTGAGCGCTTCCGGGCCCGG
  ACTGGCACGGAGCTGGTGCTGCTGACCGCGGCCCCGCCGCCACCACCCCGCCCGGGCCCCTGTGCCTAT
  GCTGCCCATGGTCGAGGAGCCCTGGCGGAGGCAGCGCGCCGTTGCCTCCACGACATCGCACTGGCCCAC
  AGGGCTGCCACTGCTGCTCGGCCTCCTGCGCCCCCACCAGCACCACAGCCACCCAGTCCCACACCCAGC
  CCACCCCGGCCTACCCTGGCCAGAGAGGACAACGAGGAGGACGAGGATGAGCCCACAGAGACAGAGACC
  TCCGGGGAGCAGCTGGGCATTAGTGATAATGGAGGGCTCTTTGTGATGGATGAGGACGCCACCCTCCAG
  GACCTTCCCCCCTTCTGTGAGTCAGACCCCGAGAGTACAGATGATGGCAGCCTGAGCGAGGAGACCCCC
  GCCGGCCCCCCCACCTGCTCAGTGCCCCCAGCCTCAGCCCTACCCACACAGCAGTACGCCAAGTCCCTG
  CCTGTGTCTGTGCCCGTCTGGGGCTTCAAGGAGAAGAGGACAGAGGCGCGGTCATCAGATGAGGAGAAT
  GGGCCGCCCTCTTCGCCCGACCTGGACCGCATCGCGGCGAGCATGCGCGCGCTGGTGCTGCGAGAGGCC
  GAGGACACCCAGGTCTTCGGGGACCTGCCACGGCCGCGGCTTAACACCAGCGACTTCCAGAAGCTGAAG
  CGGAAATATTGA
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001278160
• Insert Size: 771 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001278160.1
• RefSeq Size: 1849 bp
• RefSeq ORF: 771 bp
• Locus ID: 84335
• UniProt ID: Q96B36
• Cytogenetics: 19q13.33
• MW: 27.4 kDa
• Gene Summary: AKT1S1 is a proline-rich substrate of AKT (MIM 164730) that binds 14-3-3 protein (see YWHAH, MIM 113508) when phosphorylated (Kovacina et al., 2003 [PubMed 12524439]).[supplied by OMIM, Mar 2008]
  Transcript Variant: This variant (5) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. Variants 2, 3, 4, and 5 encode the same isoform (b).