RGS20 (NM_001286673) Human Untagged Clone

CAT#: SC334973

RGS20 (untagged) - Human regulator of G-protein signaling 20 (RGS20), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RGS20
• Synonyms: g(z)GAP; gz-GAP; RGSZ1; ZGAP1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334973 representing NM_001286673.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGCCCCAGCTTTCCCAAGATAACCAAGAGTGCCTCCAGAAACATTTCTCCAGGCCGTCTATATGGACA
  CAGTTTCTGCCCCTGTTCAGGGCTCAGAGATATAATACAGACATTCACCAAATCACAGAAAATGAAGGA
  GACCTCAGGGCTGTTCCTGATATCAAGCAGATGGGATCAGAGCGGATGGAGATGCGGAAGCGGCAGATG
  CCCGCCGCCCAGGACACACCAGGCGCCGCCCCAGGCCAGCCCGGAGCGGGGAGTCGCGGGTCCAACGCA
  TGCTGCTTCTGCTGGTGCTGCTGTTGTAGCTGCTCGTGTCTCACTGTTAGAAACCAGGAAGATCAGAGG
  CCCACAATAGCTTCCCACGAACTCAGAGCAGATCTTCCAACCTGGGAAGAAAGCCCTGCTCCTACTCTG
  GAAGAAGTCAACGCCTGGGCTCAGTCATTTGACAAATTAATGGTCACTCCAGCAGGAAGGAATGCATTC
  CGTGAATTCCTCCGAACAGAATTCAGTGAGGAAAATATGCTCTTCTGGATGGCCTGTGAGGAACTGAAA
  AAGGAAGCTAATAAAAACATTATTGAAGAGAAAGCAAGGATAATCTATGAAGACTACATTTCTATACTT
  TCTCCTAAGGAGGTGAGCTTAGACTCCCGGGTGAGAGAAGTGATCAACAGAAACATGGTGGAGCCATCC
  CAACACATATTCGATGATGCTCAACTTCAGATTTACACCCTGATGCACAGAGACTCATATCCTCGATTC
  ATGAACTCTGCTGTCTATAAGGACTTGCTTCAGTCCTTATCGGAGAAATCTATTGAAGCATAG
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001286673
• Insert Size: 822 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001286673.1
• RefSeq Size: 1760 bp
• RefSeq ORF: 822 bp
• Locus ID: 8601
• UniProt ID: O76081
• Cytogenetics: 8q11.23
• Protein Families: Druggable Genome
• MW: 31.5 kDa
• Gene Summary: The protein encoded by this gene belongs to the family of regulator of G protein signaling (RGS) proteins, which are regulatory and structural components of G protein-coupled receptor complexes. RGS proteins inhibit signal transduction by increasing the GTPase activity of G protein alpha subunits, thereby driving them into their inactive GDP-bound forms. This protein selectively binds to G(z)-alpha and G(alpha)-i2 subunits, and regulates their signaling activities. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
  Transcript Variant: This variant (3) lacks an in-frame exon in the 5' coding region comapred to variant 1. The encoded isoform (c) is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.