Calcipressin 1 (RCAN1) (NM_001285391) Human Untagged Clone

CAT#: SC335006

RCAN1 (untagged) - Human regulator of calcineurin 1 (RCAN1), transcript variant 5


  "NM_001285391" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
RCAN1 mouse monoclonal antibody,clone OTI10C6
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "RCAN1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RCAN1
Synonyms ADAPT78; CSP1; DSC1; DSCR1; MCIP1; RCN1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335006 representing NM_001285391.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAACTCTACCGTCCGCCAGCTCCGCGTTCCTTCGCACGTGCCTCTGCGGGATCCCTCGTGGGAAAGT
CTCAGAAATGTCCCTAAACTGAAGAAAAGCCGGGGAATGCAAGGAGAGCAAGGTCGTAGGTTGTTCCGA
CTGCTCCTTAACGACCTGCCTGGCAGGGACCGACTACCCTGCTCCTACCCGCAGCCCCATGTGGAGCAG
GCATCCACCAGTGCCTCCCCGCGCTTGCTAGCAGTGAACATTCCTGAAGACACTCTCCTCTCTTATCCT
GAATCCTCGCTCCCACTGCAGAGACACTGCGCCTTCCATAGGTTCTCCAAGGCCAAATTTGAGTCCCTC
TTTAGGACGTATGACAAGGACATCACCTTTCAGTATTTTAAGAGCTTCAAACGAGTCAGAATAAACTTC
AGCAACCCCTTCTCCGCAGCAGATGCCAGGCTCCAGCTGCATAAGACTGAGTTTCTGGGAAAGGAAATG
AAGTTATATTTTGCTCAGACCTTACACATAGGAAGCTCACACCTGGCTCCGCCAAATCCAGACAAGCAG
TTTCTGATCTCCCCTCCCGCCTCTCCGCCAGTGGGATGGAAACAAGTGGAAGATGCGACCCCAGTCATA
AACTATGATCTCTTATATGCCATCTCCAAGCTGGGGCCAGGGGAAAAGTATGAATTGCACGCAGCGACT
GACACCACTCCCAGCGTGGTGGTCCATGTATGTGAGAGTGATCAAGAGAAGGAGGAAGAAGAGGAAATG
GAAAGAATGAGGAGACCTAAGCCAAAAATTATCCAGACCAGGAGGCCGGAGTACACGCCGATCCACCTC
AGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001285391
Insert Size 834 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001285391.2
RefSeq Size 2533 bp
RefSeq ORF 834 bp
Locus ID 1827
UniProt ID P53805
Cytogenetics 21q22.12
Protein Families Transcription Factors
MW 31.9 kDa
Gene Summary The protein encoded by this gene interacts with calcineurin A and inhibits calcineurin-dependent signaling pathways, possibly affecting central nervous system development. This gene is located in the minimal candidate region for the Down syndrome phenotype, and is overexpressed in the brain of Down syndrome fetuses. Chronic overexpression of this gene may lead to neurofibrillary tangles such as those associated with Alzheimer disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
Transcript Variant: This variant (5) uses an alternate promoter and 5' exon compared to variant 1. The resulting isoform (e) has a distinct N-terminus compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.