DDAH2 (NM_001303008) Human Untagged Clone

CAT#: SC335075

DDAH2 (untagged) - Human dimethylarginine dimethylaminohydrolase 2 (DDAH2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DDAH2
• Synonyms: DDAH; DDAHII; G6a; HEL-S-277; NG30
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC335075 representing NM_001303008.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGGGGACGCCGGGGGAGGGGCTGGGCCGCTGCTCCCATGCCCTGATCCGGGGAGTCCCAGAGAGCCTG
  GCGTCGGGGGAAGGTGCGGGGGCTGGCCTTCCCGCTCTGGATCTGGCCAAAGCTCAAAGGGAGCACGGG
  GTGCTGGGAGGTAAACTGAGGCAACGACTGGGGCTACAGCTGCTAGAACTGCCACCTGAGGAGTCATTG
  CCGCTGGGACCGCTGCTTGGCGACACGGCCGTGATCCAAGGGGACACGGCCCTAATCACGCGGCCCTGG
  AGCCCCGCTCGTAGGCCAGAGGTCGATGGAGTCCGCAAAGCCCTGCAAGACCTGGGGCTCCGAATTGTG
  GAAATAGGAGACGAGAACGCGACGCTGGATGGCACTGACGTTCTCTTCACCGGCCGGGAGTTTTTCGTA
  GGCCTCTCCAAATGGACCAATCACCGAGGAGCTGAGATCGTGGCGGACACGTTCCGGGACTTCGCCGTC
  TCCACTGTGCCAGTCTCGGGTCCCTCCCACCTGCGCGGTCTCTGCGGCATGGGGGGACCTCGCACTGTT
  GTGGCAGGCAGCAGCGACGCTGCCCAAAAGGCTGTCCGGGCAATGGCAGTGCTGACAGATCACCCATAT
  GCCTCCCTGACCCTCCCAGATGACGCAGCTGCTGACTGTCTCTTTCTTCGTCCTGGGTTGCCTGGTGTG
  CCCCCTTTCCTCCTGCACCGTGGAGGTGGGGATCTGCCCAACAGCCAGGAGGCACTGCAGAAGCTCTCT
  GATGTCACCCTGGTACCTGTGTCCTGCTCAGAACTGGAGAAGGCTGGCGCCGGGCTCAGCTCCCTCTGC
  TTGGTGCTCAGCACACGCCCCCACAGCTGA
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001303008
• Insert Size: 858 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001303008.1
• RefSeq Size: 1278 bp
• RefSeq ORF: 858 bp
• Locus ID: 23564
• UniProt ID: O95865
• Cytogenetics: 6p21.33
• MW: 29.6 kDa
• Gene Summary: This gene encodes a dimethylarginine dimethylaminohydrolase. The encoded enzyme functions in nitric oxide generation by regulating the cellular concentrations of methylarginines, which in turn inhibit nitric oxide synthase activity. The protein may be localized to the mitochondria. Alternative splicing resulting in multiple transcript variants. [provided by RefSeq, Dec 2014]
  Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 1. Variants 1, 2, and 3 encode the same protein.