3B (NC_013115) Virus Tagged ORF Clone

CAT#: VC100688

Myc-DDK-tagged ORF clone of viral ORF for 3B [Human enterovirus 107], codon optimized for human cell expression, YP_003104793

Specifications

Product Data

• Type: Virus Tagged ORF Clone
• Tag: Myc-DDK
• Symbol: 3B
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  ORF Nucleotide Sequence

  >The Viral ORF clone VC100688 represents NCBI reference of YP_003104793 with codon optimized for human cell expression
  Red=Cloning site Blue=ORF Green=Tags(s)
  
  GACGTTGTATACGACTCCTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGGCGCGTACACAGGAATGCCGAATCAGAAGCCAAAGGTACCCACTCTGCGCCAGGCAAAGGTTCAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
  Protein Sequence

  >VC100688 representing YP_003104793
  Red=Cloning sites Green=Tags
  
  MGAYTGMPNQKPKVPTLRQAKVQ
  
  TRTRRLEQKLISEEDLAANDILDYKDDDDKV
• Restriction Sites: SgfI-MluI Cloning Scheme for this gene
• ACCN: NC_013115
• ORF Size: 69 bp
• OTI Disclaimer: The molecular sequence of this clone can be viewed by clicking the "ORF Nucleotide Sequence" link above. This sequence represents the NCBI reference after codon optimization for human cell expression, and retaining the same decuded protein sequence. The stop codon in the native sequence was removed to create the in-frame c-terminal fusion with a Myc-DDK tag.

Reference Data

• RefSeq: NC_013115.1, YP_003104793
• RefSeq ORF: 69
• MW: 2.5 kDa